Presentation is loading. Please wait.

Presentation is loading. Please wait.

Abstract Results & Discussion Introduction Materials & Methods

Similar presentations


Presentation on theme: "Abstract Results & Discussion Introduction Materials & Methods"— Presentation transcript:

1 Abstract Results & Discussion Introduction Materials & Methods
Transcriptional regulation of mammalian LTR-retrotransposon element on the human Dorfin gene Ja-Rang Lee1, Jae-Won Huh1, Dae-Soo Kim2, Kung Ahn1, Hong-Seok Ha1, Yun-Ji Kim1, Won-Ho Lee1, and Heui-Soo Kim1,2,* 1Division of Biological Sciences, College of Natural Sciences, Pusan National University, Busan , Korea 2 PBBRC, Interdisciplinary Research Program of Bioinformatics, Pusan National University, Busan , Korea Abstract Dorfin containing RING-finger and IBR motifs is an E3 ubiquitin ligase that is localized in Lewy bodies, a characteristic neuronal inclusion in Parkinson’s disease brains. The Dorfin gene located on human chromosome 8q22.2 has showed 4.4 kb transcript and expressed ubiquitously in various tissues including brain. Here we found its alternatively spliced transcript variants which derived from MaLR (mammalian LTR-retrotransposon) element using bioinformatic tools. The MaLR-derived promoter transcripts are detected as two different types in all tissues examined, while breast tissue only showed three variant types. Reporter gene assay of the promoter activity of MaLR element on Dorfin gene indicated good activity in human colon carcinoma cells (HCT-116). These findings suggest that the MaLR element acquired the role of transcriptional regulation of Dorfin gene during primate evolution.. Results & Discussion PNU Dorfin gene structure Evolutionary Conservation of the Dorfin Gene 100 77 42 Human Dog Pig Cattle Mouse Rat Zebrafish Chicken 8 Dorfin (RNF19) S1 8q22.2 MaLR 1 2 3 4 5 6 7 9 10 1a 1b AS2 S2 AluJ AS1 RING-finger/IBR ORF S3 AS3 Introduction - cloned from the anterior horn tissues category research genome transcriptome proteome Not searched in genome level cDNA sequence decision Expression pattern identification by nothern blot Transcripts expression research in ALS Identification of E3 activity Location decision of Dorfin in cell Phylogeny research in RBRfamily Homology research related with parkin Research about activity mechanism (VCP releated) Parkinson’s disease Amyotrophic lateral sclerosis NM_   Other region 16% Gene-related Sequence 36% LINE 20% SINE 13% Coding sequence 3% Pseudogene 1% HERV element 8% DNA element Expression of Dorfin gene by cellular promoter Marker Adrenal gland Adult brain Fetal brain Fetal liver Heart Kidney Liver Lung Bone marrow Cerebellum Skeletal muscle Placenta Spinal cord Testis Thymus Thyroid Trachea Uterus Prostate Dorfin Gapdh 494 bp 195 bp Breast (N) Breast (C) Marker AAGGGAGCTAAATGGCGGGGTGGATGGAATTGCAAGTATTGAAAGTATAC R L E G N D V I A S GCACGGCCCAGCTGGATTTTGGACTTCTGGCCTCCAGAACTAGACAGGGC CTCACTGTGTCACCCAGGGTGGAATACAGTGGTGTGATCATAGCTCACTG CAGCCTGGAATTCCTGGGCTCAAGCAACCCTGCCACCTCAGCCTTCCAAG TAGCTAGGACTACAGAACATCCATGATAGCAGTCTTCTGTAAATCGAACT TTTCAAGAATTCTCTGAAGGAACCAAGTAGGATATTCTTACATCATGACT TAATGTGAATGCAAGAACAAGAAATAGGTTTTATCTCTAAATATAATGAA GGGCTGTGTGTAAACACTGACCCTGTCTCAATTCTAACAAGCATTTTAGA CATGAGTTTACATCGGCAAATGGGTTCAGATCGAGATCTTCAGTCCTCTG CTTCATCTGTGAGCTTGCCTTCAGTCAAAAAGGCACCCAAAAAAAGAAGA ATTTCAATAGGCTCCCTGTTTCGGAGGAAAAAAGATAACAAACGTAAATC AGAAGCTGGAAGAGTCAAAGGACACATTCTCCCCTCAAGCCCCAGTGGGA Primer S2 Primer AS2 M Q F K Y C T P H AluJ element 556 bp 430 bp 315 bp (A) (B) (C) 3 11 1 2 MaLR AluJ 10 126 bp 115 bp 1) 2) 3) MaLR-derived promoter transcript (556 bp) transcript (430 bp) Relative Expression Bone marrow Cerebellum Kidney Lung Testis Expression of Dorfin gene by MaLR-derived promoter Materials & Methods Luciferase assay Gene cloning RT-PCR Primer Design Twenty Different Human tissue cDNAs Quantitative Analysis Real-time PCR Luciferase assay Modified PGL2-vector, HCT116, Cos7, Lipofectamine, Dual luciferase Assay Gene cloning Qiaquick Gel-extraction, Promega T-easy Vector, EcoR-I(DH5α) 35cycle 94 ℃ : 40sec 56 ℃ : 30sec 72 ℃ : 40sec. Real-time PCR 40cycle (Sybr green) 94 ℃ : 10sec 56 ℃ : 15sec 72 ℃ : 15sec In silico analysis of transcription binding sites of MaLR element Promoter Activity of the MaLR Element CCCCACAAAA GATATGTTCA TGTCCTAATC CCCAGAATCT GCAAATGTTA TTTGGAAAAA GGGGTTTTGC AGATGTAATT AAGTTAAGAA TCTTGAGATA AGATCATCCT GGATTATCCA GGTAGCCTCA AAATCAAGTG ACAAGTGTCT TTGTAAGGGA CAAGTAGACC CATTACAGAG AAGACGACGC GCAGAAAAGG AGGAAGCAGT GTGCTCATGG AGGCGGAGAT TGGAGTGATG TAACCGCAAG CCGAGGAATG CTTATAGTCA CCAGAAGCTG GAAGAGTCAA AGGACACATT CTCCCCTCAA GCCCCAGTGG GAGCACGGCC CAGCTGGATT TTGGACTTCT GGCCTCCAGA ACTGTAAGAG AAATGTCCAT TGTCTTAAGC CAACCAGTTT GTGGTAGTTT GTTACAGCAG CCCCAGGAAA CTACTA GATA-1 Reverse Forward Control Relative Luciferase Activity (Fold of pGL-2 control) Cos7 HCT116 GATA-2 Nkx2-5 Nkx2-5 Whn ELF-1 References +1 TRANSCRIPTION START SITE Sin HS, Huh JW, Kim DS, Kang DW, Min DS, Kim TH, Ha HS, Kim HH, Lee SY, Kim HS Transcriptional control of the HERV-H LTR element of the GSDML gene in human tissues and cancer cells. Arch. Virol. [Epub ahead of print] 1. Sin HS, Huh JW, Kim DS, Kang DW, Min DS, Kim TH, Ha HS, Kim HH, Lee SY, Kim HS Transcriptional control of the HERV-H LTR element of the GSDML gene in human tissues and cancer cells. Arch. Virol. [Epub ahead of print] Hishikawa N, Niwa J, Doyu M, Ito T, Ishigaki S, Hashizume Y, Sobue G Dorfin localizes to the ubiquitylated inclusions in Parkinson's disease, dementia with Lewy bodies, multiple system atrophy, and amyotrophic lateral sclerosis. Am J Pathol. 163(2): 2. Hishikawa N, Niwa J, Doyu M, Ito T, Ishigaki S, Hashizume Y, Sobue G Dorfin localizes to the ubiquitylated inclusions in Parkinson's disease, dementia with Lewy bodies, multiple system atrophy, and amyotrophic lateral sclerosis. Am J Pathol. 163(2):


Download ppt "Abstract Results & Discussion Introduction Materials & Methods"

Similar presentations


Ads by Google