1. Brown iGEM international genetically engineered machines competition July Update 1/86

2. What is iGEM? Biology Engineering Standardization 2/86

3. Making it easier to engineer biology 3/86

4. DNA is a language: AATGAATATCCAGATCG 4/86

5. Biological Part: Promoter 5/86

6. --- Different Parts connect together --- Gene Terminator This is a device Promoter 6/86

7. --- Different Parts connect together Constitutive Promoter --- Terminator This is a device GFP 7/86

8. Biological parts are building blocks made of genetic material 8/86

9. Science Systematic engineering Standardizing biology Apply biological technology 9/86

10. Brown iGEM Lead-detector Tri-stable Switch Two projects being built with biological parts 10/86

11. Lead Detector 11/86

12. Version 1.0: Lead Detector Fluorescent Protein Lead Promoter Problem: Only one cell will light up! 12/86

13. Version 1.1: Amplify the Signal Fluorescent Protein Lead Promoter Amplifier Problem: Promoter Leakiness = False Positives! 13/86

14. Version 1.2: Filter False Positives Three Possible Solutions: 1.Modify the Promoter (weaker baseline) 2.Tight intermediate promoter (T7) 3. Make amplifier less sensitive (increase threshold) 14/86

15. Final Version: The System Fluorescent Protein Lead Promoter Amplifier Leakiness Filter 15/86

16. So how will this system work in the cell? 16/86

17. TetR (always on) PbrR LuxR Lead Promoter LuxI pLux LuxIGFP NO LEAD Transcription factors are constitutively made by the first promoter. These proteins are poised to activate the Lead Detector promoter and Message Receiver promoter upon addition of lead. 17/86

18. LuxR Lead Promoter LuxI pLux LuxIGFP + Fluorescent Protein Output Lead turns on Detector promoter TetR (always on) PbrR 18/86

19. Experimental Design iGEM’s more than just design. This will take some lab work. 19/86

20. Experimental Design Three Independent System Components AHL unifies three components with a common language to match Inputs with Outputs. Lead Receptor and Promoter Filter Amplifier 20/86

21. Experimental Design Three Independent System Components AHL unifies three components with a common language to match Inputs with Outputs. Lead Receptor and Promoter Filter Amplifier Develop AHL Assay for testing all components. STEP 1 STEP 2a and 2b STEP 3 21/86

22. What is AHL? Cell Signaling Molecule Common input and output of different devices within our system Why and How do we measure it? Acyl Homoserine Lactone 22/86

23. AHL BioAssay 23/86

24. More AHL --> More GFP Need more than 10 nM AHL to overcome threshold AHL BioAssay 24/86

25. Experimental Design Lead Receptor and Promoter Filter Amplifier Develop AHL Assay for testing all components. STEP 1 STEP 2a and 2b STEP 3 25/86

26. Amplifier Chemical Transformation Electroporation Ordering from MIT Build it ourselves Measure AHL output 26/86

27. Experimental Design Lead Receptor and Promoter Filter Amplifier Develop AHL Assay for testing all components. STEP 1 STEP 2a and 2b STEP 3 27/86

28. Lead Receptor and Promoter Ralstonia Metallidurans CH34 Survives in metallic environments. http://genome.jgi-psf.org/finished_microbes/ralme/ralme.home.html 28/86

29. Lead Receptor and Promoter We chose to examine: 1.Lead Receptor Protein PbrR691 2. Corresponding Lead Promoter PbrR691 Lead Promoter 29/86

30. Lead Receptor and Promoter Why? –Incredibly Selective! –Novel –Successfully cloned into E Coli. 30/86 Chen, Peng, Bill Greenberg, Safiyah Taghavi, Christine Romano, Daniel van der Lelie, and Chuan He. “An Exceptionally Selective Lead(II)-Regulatory Protein from Ralstonia Metallidurans: Development of a Fluorescent Lead(II) Probe.” Angew. Chem. Int. Ed. 2005, 44, 2-6.

31. Original Design pTet (Constitutive On) PbrR691 Lead Promoter Amplifier PbrR691 31/86

32. Lead Receptor PbrR691 and Lead Promoter must be BioBricked! PbrR691 GACTGATCGATAGATCGAGATCGATCGATAGAGGCTCTCGAGATCGCGAGATATCG 32/86

33. BioBrick Assembly 33/86

34. How do we get PbrR691 and Lead Promoter? PCR 2 Major Obstacles: - Biobricking a promoter adds extra bases from the restriction sites to the ends, which may reduce promoter efficiency. - Length of promoter – very small 34/86

35. Experimental Plan Purpose: Match switch components PCR 12 variations of promoter and gene Ligate to RBS-LuxI-GFP-Term Test with AHL against AHL bioassay curve Result: promoter output = amplifier input 35/86

36. Experimental Design Lead Receptor and Promoter Filter Amplifier Develop AHL Assay for testing all components. STEP 1 STEP 2a and 2b STEP 3 36/86

37. Problem: Leakiness What if the baseline is too high? Possible solution: T7 promoter control Advantage: strong repression (not leaky) unless T7 RNA polymerase is present 37/86

38. T7 Promoter LuxI T7 polymerase will transcribe LuxI pPbr T7 polymerase Amplifier T7 Filter Schematic 38/86

39. Possible Issues Poor sensitivity Poor pPbr induction Solution: Need to test pPbr promoter as well as whole T7 system What are our choices for T7 systems? 39/86

40. T7 registry parts 40/86

41. Experimental Design Lead Receptor and Promoter Filter Amplifier Develop AHL Assay for testing all components. STEP 1 STEP 2a and 2b STEP 3 41/86

42. Tri-Stable Switch 42/86

43. Tristable Switch Team 1.Introduction 2.System Design 3.Modeling 4.System Tests 5. Labwork 43/86

44. Introduction Stable Switch: A system with 2 or more distinct and inducible states. AB Introduction > System Design > Modeling > System Tests > Labwork 44/86

45. Bistable Switch This is the simplest switch. It only involves two separate states. Introduction > System Design > Modeling > System Tests > Labwork 45/86

46. Uses for a Bistable Switch Drug Delivery Simple Logic Introduction > System Design > Modeling > System Tests > Labwork 46/86

47. Bistable Switch In 2000, three scientists at Boston University managed to create a synthetic Bistable Switch. They showed that you could create the Bistable Switch using relatively simple, standard parts. Introduction > System Design > Modeling > System Tests > Labwork 47/86

48. Bistable Switch Design The Bistable Switch simply consists of two pathways, each of which represses the other. pLacTetR pTetLacI GFP YFP Pathway A Pathway B Introduction > System Design > Modeling > System Tests > Labwork 48/86

49. Importance of Bistable Switch The Bistable Switch is one of the seminal achievements of Synthetic Biology. It was one of the first projects that showed that you could combine standard genetic parts together to form working circuits. Introduction > System Design > Modeling > System Tests > Labwork 49/86

50. Tristable Switch A switch with three distinct inducible states. ABC Introduction > System Design > Modeling > System Tests > Labwork 50/86

51. Tristable Switch Design The design consists of three pathways, each of which represses the other two. When one of the pathways is induced it stops the other two from being expressed, and the system achieves stability. Introduction > System Design > Modeling > System Tests > Labwork 51/86

52. pTet LacI AraC pLac AraC TetR pAra TetR LacI Pathway A Pathway B Pathway C Tristable Switch Design Introduction > System Design > Modeling > System Tests > Labwork 52/86

53. Tristable Switch Tuning While the design is relatively simple, the exact components we put into it have to be carefully chosen to balance the system. pTet LacI AraC Introduction > System Design > Modeling > System Tests > Labwork 53/86

54. Why do we model? Modeling Introduction > System Design > Modeling > System Tests > Labwork A quick and inexpensive way to quantitatively predict behavior A foundation to start testing, e.g. what variables do we need to test to understand our system 54/86

55. Why does our system lend itself to modeling? Modeling Sensitive system Future adaptations Introduction > System Design > Modeling > System Tests > Labwork 55/86

56. Variables in the Model 1.Rate of repressor production 2.Strength of repression Introduction > System Design > Modeling > System Tests > Labwork 56/86

57. Variables in the Model Rate of repressor production depends on: 1.Promoter strength (transcription) 2.RibosomeBindingSite strength (translation) RBS In model, α = Promoter * RBS = total repressor production rate Introduction > System Design > Modeling > System Tests > Labwork 57/86

58. Variables in the Model Repressor strength depends on: 1. β = the cooperativity of repressors to promoters 2. [repressor] = the concentration of repressor Total strength of repressor = [repressor]^  Introduction > System Design > Modeling > System Tests > Labwork 58/86

59. Variables in the Model Graph of [repressor]^  ; where  =.5, 1, 1.5, 2 *β = cooperativity of repression Introduction > System Design > Modeling > System Tests > Labwork 59/86

60. Equations For the Bi-Stable Switch… x and y = [repressor concentration] α = repressor production rate β = cooperativity of repression Introduction > System Design > Modeling > System Tests > Labwork 60/86

61. Equations The equations are extended to a tri stable system. Vs. BistableTristable Introduction > System Design > Modeling > System Tests > Labwork 61/86

62. Equations The number of repressors correlates to the number of terms Introduction > System Design > Modeling > System Tests > Labwork 62/86

63. The Bi Stable Region β = cooperativity α = repressor production rate Introduction > System Design > Modeling > System Tests > Labwork 63/86

64. The Tri Stable Region Introduction > System Design > Modeling > System Tests > Labwork 64/86

65. What the Model Predicts β > 1 or larger to maximize the stable region α values are similar for all promoters α values are within the stable region A stable system occurs when: β = cooperativity α = repressor production rate Introduction > System Design > Modeling > System Tests > Labwork 65/86

66. So what can we do with the modelling? Introduction > System Design > Modeling > System Tests > Labwork 66/86

67. 1. Systematic Approach to Construction Design tests to assign values to variables in model –Promoter/RBS Strength, Relative Repressor Cooperativity, etc Use these values in the model to find the right combination of parts. Introduction > System Design > Modeling > System Tests > Labwork 67/86

68. Alternative: test, hope it works, if not, test again. Systematic Design is the philosophy of Synthetic Biology Introduction > System Design > Modeling > System Tests > Labwork 68/86

69. 2. Characterization of System It is a step towards standardization - giving others all the details needed to use the part. Introduction > System Design > Modeling > System Tests > Labwork 69/86

70. Testing Constructs 1.(  ) Promoter/RBS Strength 2.(  ) Repressor Strength 3.Inducer Strength Introduction > System Design > Modeling > System Tests > Labwork 70/86

71. Promoter/RBS Strength Promoter RBS GFP variable **Because there is no way to measure strength or concentration directly, we measure with florescent proteins. Introduction > System Design > Modeling > System Tests > Labwork 71/86

72. Repressor Strength Inducible Promoter RBS Repressor GFP Repressible Promoter RBS YFP Variable β = cooperativity α = repressor production rate Introduction > System Design > Modeling > System Tests > Labwork 72/86

73. Inducer Strength Promoter RBS Repressor Promoter RBS GFP X Variable [Inducer] Introduction > System Design > Modeling > System Tests > Labwork 73/86

74. Testing Restraints Florescent proteins not perfect read out: 1.Indirect measurement of gene a. Protein folding time b. Degradation Rate 2.Rate of Production: Repressor vs GFP 3.High toll on cell machinery and resources Introduction > System Design > Modeling > System Tests > Labwork 74/86

75. What we’ve been up to… Introduction > System Design > Modeling > System Tests > Labwork 75/86

76. KABOBS Introduction > System Design > Modeling > System Tests > Labwork 76/86

77. Mastering Cloning More obstacles than we thought Transformations, DNA concentration too low, gel readibility, restriction digest buffer compatibility, etc. Most kinks worked out of the way First ligations completed Introduction > System Design > Modeling > System Tests > Labwork 77/86

78. The Project Itself Looking through Modeling Designed Tests Created DNA stocks of all parts needed Creating a good record keeping infrastructure Introduction > System Design > Modeling > System Tests > Labwork 78/86

79. Introduction > System Design > Modeling > System Tests > Labwork 79/86

80. Goals Testing Ligations Introduction > System Design > Modeling > System Tests > Labwork 80/86

81. Introduction > System Design > Modeling > System Tests > Labwork 81/86

82. References Gardner TS, Cantor CR, Collins JJ. “Construction of a genetic toggle Switch in Escherichia coli.” Nature 2000 Jan, 20. Introduction > System Design > Modeling > System Tests > Labwork 82/86

83. 2007 Brown iGEM Team 7 undergraduates 7 grad student advisors 2 Faculty advisors 9 faculty sponsors 83/86

84. Sponsors 84/86

85. Office of the Dean of the College Office of the President The Atlantic Philanthropies The Center for Computational and Molecular Biology Department of Physics Engineering Department Department of Molecular Biology, Cell Biology, and Biochemistry Department of Molecular Pharmacology, Physiology, and Biotechnology The Multi Disciplinary Lab Pfizer Labnet Nanodrop Special Thanks To: 85/86

86. Thank you for listening! Questions? 86/86