Presentation is loading. Please wait.

Presentation is loading. Please wait.

Ortholog vs. paralog? 1. Collect Sequence Data Good Dataset

Published byMonique Green Modified over 9 years ago

Similar presentations

Presentation on theme: "Ortholog vs. paralog? 1. Collect Sequence Data Good Dataset"— Presentation transcript:

1 Ortholog vs. paralog? 1. Collect Sequence Data Good Dataset
B species 1 species 2 species 3 species 4 A1 B1 A2 B2 A4 B4 A3 B3 Good Dataset Bad Dataset Draw resulting trees [A1, A2, A3, A4] [A1, B2, A3, A4] OEB 192 –

2 Alignment taxa1 CGGATAAAC taxa2 CGGATAGAC taxa3 CGCTGATAAAC taxa4
2. Sequence Alignment CGGATAAAC CGGATAGAC CGCTGATAAAC CGGATAC taxa1 taxa2 taxa3 taxa4 CG--GATAAAC CG--GATAGAC CGCTGATAAAC CG--GAT--AC

3 Choose methods: distance-based
Example: Neighbor Joining (NJ) Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA Species C TTCACTAGACCTGTGGTCCA Species D TTGACCAGACCTGTGGTCCG Species E TTGACCAGTTCTCTAGTTCG A B C D E Species A Species B Species C Species D Species E A B C D E Species A Species B Species C Species D Species E M(AB)=d(AB) -[(r(A) + r(B))/(N-2)] A B C D E Insert node connecting pair most relatively close to each other, than repeat for U1, C, D, E

4 Discrete character methods
4. Choose Methods Discrete character methods Maximum Parsimony (MP): Model: Evolution goes through the least number of changes Maximum Likelihood (ML): L (data| model) Adjust the internal node to minimize the sum of changes of all characters Scores trees for that most likely given the model parameters Bayesian Inference

5 ? Choose “model” 3. Choose Models Ancestral Sequences Model
Observed Sequences ? Model Substitution models (arrows between all nucleotides) 12 rates, 4 equilibrium frequencies, indels

6 Assess reliability 5. Assess Reliability
Re-sampling to produce pseudo-dataset (random weighting) CGATCGTTA CAATGATAG CGCTGATAA CGCTGATCG taxa1 taxa2 taxa3 taxa4 100 73 I. Bootstrap Sampling with replacement II. Jacknife Random deletion of sub-dataset Randomize dataset to build null likelihood distribution III. Permutation test

7 Utility of phylogeny: Molecular clock
5. Assess Reliability How assess timeline? Made tree (ML) & regressed branch length against year. Ancestor of M clade: 1931 (95% c.i. made via bootstraps: ) – Do you believe it? There is a recovered Zaire sequence, for which they predict would have occurred 1957 (actually 1959)… (Korber et al., 2000)

8 Utility of phylogeny: Molecular clock
5. Assess Reliability How assess timeline? Made tree (ML) & regressed branch length against year. Ancestor of M clade: 1931 (95% c.i. made via bootstraps: ) – Do you believe it? There is a recovered Zaire sequence, for which they predict would have occurred 1957 (actually 1959)… (Korber et al., 2000)

9 Utility of phylogeny: Molecular clock
5. Assess Reliability How assess timeline? Made tree (ML) & regressed branch length against year. Ancestor of M clade: 1931 (95% c.i. made via bootstraps: ) – Do you believe it? There is a recovered Zaire sequence, for which they predict would have occurred 1957 (actually 1959)… (Hillis, 2000)

10 Utility of phylogeny: infer past environment?
Was the ancestor of bacteria a thermophile? Reconstructed EF-Tu at key nodes All ancestral types have high Topt (Gaucher et al., 2003)

11 Molecular signs of selection
Several, dn/ds most common 1 = neutrality; <1 purifying selection; >1 positive selection (particularly sustained) – ex: extreme values show up for genes interacting with immune system (Sawyer & Malik, 2006)

12 Genetic exchange in bacteria/archaea
Transformation Used by Griffiths, and later Avery to show DNA is genetic material Some bacteria naturally competent Transduction Generalized & specialized Conjugation High-frequency recombinants (Hfr) Rare, partial and unidirectional Can be novel genes or new alleles (homologous rec.)

13 Two “types” of HGT… Transformation Transduction Conjugation
Used by Griffiths, and later Avery to show DNA is genetic material Some bacteria naturally competent Transduction Generalized & specialized Conjugation High-frequency recombinants (Hfr) Rare, partial and unidirectional Can be novel genes or new alleles (homologous rec.)

14 Comparison of HGT to “normal” sex
Transformation Used by Griffiths, and later Avery to show DNA is genetic material Some bacteria naturally competent Transduction Generalized & specialized Conjugation High-frequency recombinants (Hfr) Rare, partial and unidirectional Can be novel genes or new alleles (homologous rec.)

15 Monday (9/19): Horizontal gene transfer

Download ppt "Ortholog vs. paralog? 1. Collect Sequence Data Good Dataset"

Similar presentations

CS 598AGB What simulations can tell us. Questions that simulations cannot answer Simulations are on finite data. Some questions (e.g., whether a method.

CS 598AGB What simulations can tell us. Questions that simulations cannot answer Simulations are on finite data. Some questions (e.g., whether a method.
. Class 9: Phylogenetic Trees. The Tree of Life Evolution u Many theories of evolution u Basic idea: l speciation events lead to creation of different.

. Class 9: Phylogenetic Trees. The Tree of Life Evolution u Many theories of evolution u Basic idea: l speciation events lead to creation of different.
An Introduction to Phylogenetic Methods

An Introduction to Phylogenetic Methods
1 General Phylogenetics Points that will be covered in this presentation Tree TerminologyTree Terminology General Points About Phylogenetic TreesGeneral.

1 General Phylogenetics Points that will be covered in this presentation Tree TerminologyTree Terminology General Points About Phylogenetic TreesGeneral.
Molecular Evolution Revised 29/12/06

Molecular Evolution Revised 29/12/06
Lecture 7 – Algorithmic Approaches Justification: Any estimate of a phylogenetic tree has a large variance. Therefore, any tree that we can demonstrate.

Lecture 7 – Algorithmic Approaches Justification: Any estimate of a phylogenetic tree has a large variance. Therefore, any tree that we can demonstrate.
BIOE 109 Summer 2009 Lecture 4- Part II Phylogenetic Inference.

BIOE 109 Summer 2009 Lecture 4- Part II Phylogenetic Inference.
“Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.

“Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation.
What can sequences tell us? BIOL E-127– 10/15/07.

What can sequences tell us? BIOL E-127– 10/15/07.
OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical.

OEB 192 – “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical.
Phylogeny. Reconstructing a phylogeny  The phylogenetic tree (phylogeny) describes the evolutionary relationships between the studied data  The data.

Phylogeny. Reconstructing a phylogeny  The phylogenetic tree (phylogeny) describes the evolutionary relationships between the studied data  The data.
Phylogenetic reconstruction

Phylogenetic reconstruction
More on neutral theory OEB 192 – 10.09.15. Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA.

More on neutral theory OEB 192 – Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA.
Dispersal models Continuous populations Isolation-by-distance Discrete populations Stepping-stone Island model.

Dispersal models Continuous populations Isolation-by-distance Discrete populations Stepping-stone Island model.
Bas E. Dutilh Phylogenomics Using complete genomes to determine the phylogeny of species.

Bas E. Dutilh Phylogenomics Using complete genomes to determine the phylogeny of species.
. Class 9: Phylogenetic Trees. The Tree of Life D’après Ernst Haeckel, 1891.

. Class 9: Phylogenetic Trees. The Tree of Life D’après Ernst Haeckel, 1891.
Gene transfer Organismal tree: species B species A species C species D Gene Transfer seq. from B seq. from A seq. from C seq. from D molecular tree: speciation.

Gene transfer Organismal tree: species B species A species C species D Gene Transfer seq. from B seq. from A seq. from C seq. from D molecular tree: speciation.
BIOS E-127 – 08.09.29. Phenetics vs. cladistics Lysozyme amino acid changes in unrelated ruminants Phenetics vs. cladistics.

BIOS E-127 – Phenetics vs. cladistics Lysozyme amino acid changes in unrelated ruminants Phenetics vs. cladistics.
Probabilistic methods for phylogenetic trees (Part 2)

Probabilistic methods for phylogenetic trees (Part 2)
Phylogenetic Analysis. 2 Phylogenetic Analysis Overview Insight into evolutionary relationships Inferring or estimating these evolutionary relationships.

Phylogenetic Analysis. 2 Phylogenetic Analysis Overview Insight into evolutionary relationships Inferring or estimating these evolutionary relationships.

Similar presentations

Ads by Google