1. Introduction to DNA Lecture notes edited by John Reif from PPT lectures by: Image from http://zen-haven.dkhttp://zen-haven.dk Natalia Tretyakova, College of Pharmacy, U. of Minnesota Richard Lavery, Institut de Biologie Physico-Chimique, Paris

2. DNA Double helix Stores genetic code as a linear sequence of bases ≈ 20 Å in diameter Human genome ≈ 3.3 x 10 9 bp ≈ 25,000 genes Richard Lavery Institut de Biologie Physico-Chimique, Paris

3. DNA Size Scale

4. Biological length scale Chemical bond1 Å(10 -10 m) Amino acid10 Å(10 -9 m) Globular protein100 Å(10 -8 m) Virus1000 Å(10 -7 m) Cell nucleus1  m(10 -6 m) Bacterial cell5  m(10 -5 m) Chromosome DNA10 cm(10 -1 m) Richard Lavery Institut de Biologie Physico-Chimique, Paris

5. DNA BASES

6. Nucleoside Nucleotide OH ribose H deoxyribose Richard Lavery Institut de Biologie Physico-Chimique, Paris The Building Blocks of DNA

7.  Nucleotides are linked by phosphodiester bonds  Strand has a direction (5'  3')  DNA is negatively charged on phosphate backbone. Richard Lavery Institut de Biologie Physico-Chimique, Paris

8. Base families Purine (Pur / R)Pyrimidine (Pyr / Y) C2 N1 C5 C6 N7 C4 C8 N9 N3 N1 C4 N3 C2 C5 C6 Richard Lavery Institut de Biologie Physico-Chimique, Paris

9. DNA and RNA nucleobases (DNA only) (RNA only) Natalia Tretyakova College of Pharmacy, U. of Minnesota

10. Purine Bases The 9 atoms that make up the fused rings (5 carbon, 4 nitrogen) are numbered 1-9. All ring atoms lie in the same plane. Richard B. Hallick Introductory Course in Biology or Biochemistry

11. Purine Nucleotides Natalia Tretyakova College of Pharmacy, U. of Minnesota

12. Pyrimidine Bases All pyrimidine ring atoms lie in the same plane. Richard B. Hallick Introductory Course in Biology or Biochemistry

13. Pyrimidine Nucleotides Natalia Tretyakova College of Pharmacy, U. of Minnesota

14. nucleobase(Deoxy) nucleoside 5’-mononucleotide Adenine (A) Guanine (G) Thymine (T) Cytosine (C) Uracil (U) 2’-Deoxyadenosine (dA) 2’- Deoxyguanosine (dG) 2’- Deoxythymidine (dT) 2’- Deoxycytidine (dC) Uridine (U) Deoxyadenosine 5’-monophosphate (5’-dAMP) Deoxyguanosine 5’-monophosphate (5’-dGMP) Deoxythymidine 5’-monophosphate (5’-dTMP) Deoxycytidine 5’-monophosphate (5’-dCMP) Uridine 5’-monophosphate (5’-UMP) Nomenclature of nucleobases, nucleosides, and mononucleotides Natalia Tretyakova College of Pharmacy, U. of Minnesota

15. Structural differences between DNA and RNA DNA RNA Natalia Tretyakova College of Pharmacy, U. of Minnesota

16. Deoxyribose Sugar The hydroxyl groups on the 5'- and 3'- carbons link to the phosphate groups to form the DNA backbone. Richard B. Hallick Introductory Course in Biology or Biochemistry

17. Richard B. Hallick Introductory Course in Biology or Biochemistry Nucleosides A nucleotide is a nucleoside with one or more phosphate groups covalently attached to the 3'- and/or 5'-hydroxyl group(s).

18. Preferred conformations of nucleobases and sugars in DNA and RNA 7.0 A 5.9 A Sugar puckers: Natalia Tretyakova College of Pharmacy, U. of Minnesota

19. Nucleosides Must Be Converted to 5’-Triphosphates to be Part of DNA and RNA Natalia Tretyakova College of Pharmacy, U. of Minnesota

20. DNA BASE PAIRING

21. Watson-Crick base pairs Thymine -AdenineCytosine -Guanine Richard Lavery Institut de Biologie Physico-Chimique, Paris

22. Richard B. Hallick Introductory Course in Biology or Biochemistry A-T and G-C Base Pairing

23. Hydrogen bond donors and acceptors on each edge of a base pair Natalia Tretyakova College of Pharmacy, U. of Minnesota

24. Richard Lavery Institut de Biologie Physico-Chimique, Paris Purine always binds with a Pyrimidine

25. Base pair dimensions Richard Lavery Institut de Biologie Physico-Chimique, Paris

26. DNA/RNA chemical structure DNA : A,T,G,C + deoxyribose RNA : A,U,G,C + ribose Richard Lavery Institut de Biologie Physico-Chimique, Paris

27. DNA BACKBONE STRUCTURE

28. Richard B. Hallick Introductory Course in Biology or Biochemistry Backbone structure: Alternating backbone of deoxyribose and phosphodiester groups Chain has a direction (known as polarity), 5'- to 3'- from top to bottom Oxygens (red atoms) of phosphates are polar and negatively charged Bases extend away from chain, and stack atop each other Bases are hydrophobic Helix Axis View:

29. OnScreen DNA Model app

30. B-DNA STRUCTURE

31. Video of DNA Helix Structure: http://www.youtube.com/watch?v=ZGHkHMoyC5I Contains material from: Alberts, Bray, Hopkin, Johnson, Lewis, Raff, Roberts, Walter, Essential Cell Biology, Second Edition, Garland Science Publishing, 2004

32. CGCGTTGACAACTGCAGAATC Richard Lavery Institut de Biologie Physico-Chimique, Paris B-DNA Structure

33. Richard B. Hallick Introductory Course in Biology or Biochemistry Features of the B-DNA Double Helix Two DNA strands form a helical spiral, winding around a helix axis in a right-handed spiral The two polynucleotide chains run in opposite directions The sugar-phosphate backbones of the two DNA strands wind around the helix axis like the railing of a sprial staircase The bases of the individual nucleotides are on the inside of the helix, stacked on top of each other like the steps of a spiral staircase.

34. B-DNA (axial view) Richard Lavery Institut de Biologie Physico-Chimique, Paris

35. B-DNA (lateral view) R.H. helix Richard Lavery Institut de Biologie Physico-Chimique, Paris

36. Base stacking: an axial view of B-DNA Natalia Tretyakova College of Pharmacy, U. of Minnesota

37. PI Bonds – (Mechanism of PI Base Stacking)

38. Forces stabilizing DNA double helix 1.Hydrogen bonding (2-3 kcal/mol per base pair) 2.Stacking (hydrophobic) interactions (4-15 kcal/mol per base pair) 3.Electrostatic forces. Natalia Tretyakova College of Pharmacy, U. of Minnesota Comparison to other bonds 1.Covalent Bond Energies: 1.C-C 85 kcal/mol 2.C-O 87 kcal/mol

39. right handed helix planes of bases are nearly perpendicular to the helix axis. Sugars are in the 2’ endo conformation. Bases are the anti conformation. Bases have a helical twist of 34.6º (10.4 bases per helix turn) Helical pitch = 34 A B-DNA 3.4 A rise between base pairs Wide and deep Narrow and deep 7.0 A helical axis passes through base pairs 23.7 A Natalia Tretyakova College of Pharmacy, U. of Minnesota

40. DNA can deviate from the ideal Watson-Crick structure Helical twist ranges from 28 to 42° Propeller twisting 10 to 20° Base pair roll Natalia Tretyakova College of Pharmacy, U. of Minnesota

41. DNA grooves MINOR MAJOR Richard Lavery Institut de Biologie Physico-Chimique, Paris

42. Major groove and Minor groove of DNA NH N N O 2 N N N H 2 N O C-1’ HN N O O N N N N NH 2 C-1’ To deoxyribose-C1’C1’ -To deoxyribose Hypothetical situation: the two grooves would have similar size if dR residues were attached at 180° to each other Natalia Tretyakova College of Pharmacy, U. of Minnesota

43. Major and minor groove of the double helix Wide and deep Narrow and deep NH N N O 2 N N N H 2 N O C-1’ HN N O O N N N N NH 2 C-1’ Natalia Tretyakova College of Pharmacy, U. of Minnesota

44. B-type duplex is not possible for RNA steric “clash” Natalia Tretyakova College of Pharmacy, U. of Minnesota

45. A-DNA STRUCTURE

46. A and B DNA allomorphs B A Hydration Antiparallel strands 5’5’ 5’5’ 3’3’ 3’3’ Richard Lavery Institut de Biologie Physico-Chimique, Paris De-hydration

47. A-DNA (longitudinal view) Richard Lavery Institut de Biologie Physico-Chimique, Paris

48. A-DNA (lateral view) R.H. helix Richard Lavery Institut de Biologie Physico-Chimique, Paris

49. A-form helix: dehydrated DNA; RNA-DNA hybrids Top View Right handed helix planes of bases are tilted 20 ° relative the helix axis. 2.3 A rise between base pairs Sugars are in the 3’ endo conformation. Bases are the anti conformation. 11 bases per helix turn Helical pitch = 25.3 A 25.5 A Natalia Tretyakova College of Pharmacy, U. of Minnesota

50. The sugar puckering in A-DNA is 3’-endo 7.0 A 5.9 A Natalia Tretyakova College of Pharmacy, U. of Minnesota

51. A-DNA has a shallow minor groove and a deep major groove B-DNA Helix axis A-DNA Natalia Tretyakova College of Pharmacy, U. of Minnesota

52. Z-DNA STRUCTURE

53. Z-DNA (longitudinal view) Richard Lavery Institut de Biologie Physico-Chimique, Paris

54. Z-DNA (lateral view) L.H. helix Richard Lavery Institut de Biologie Physico-Chimique, Paris

55. Base pairs are rotated in Z-DNA Richard Lavery Institut de Biologie Physico-Chimique, Paris

56. Z-form double helix: polynucleotides of alternating purines and pyrimidines (GCGCGCGC) at high salt Left handed helix Backbone zig-zags because sugar puckers alternate between 2’ endo pyrimidines and 3’ endo (purines) Bases alternate between anti (pyrimidines) and syn conformation (purines). 12 bases per helix turn Helical pitch = 45.6 A planes of the bases are tilted 9° relative the helix axis. Flat major groove Narrow and deep minor groove 18.4 A 3.8 A rise between base pairs Natalia Tretyakova College of Pharmacy, U. of Minnesota

57. Sugar and base conformations in Z-DNA alternate : 5’-GCGCGCGCGCGCG 3’-CGCGCGCGCGCGC C: sugar is 2’-endo, base is anti G: sugar is 3’-endo, base is syn Natalia Tretyakova College of Pharmacy, U. of Minnesota

58. Comparing A, B and Z-DNA

59. Natalia Tretyakova College of Pharmacy, U. of Minnesota

60. Biological relevance of the minor types of DNA secondary structure Although the majority of chromosomal DNA is in B-form, some regions assume A- or Z-like structure Runs of multiple Gs are A-like The upstream sequences of some genes contain 5-methylcytosine = Z-like duplex RNA-DNA hybrids and ds RNA have an A-type structure Structural variations play a role in DNA-protein interactions Natalia Tretyakova College of Pharmacy, U. of Minnesota

62. Backbone Dihedrals

63. Backbone dihedrals - I 0 Richard Lavery Institut de Biologie Physico-Chimique, Paris

64. +60° +10° Dihedral angle definition StaggeredEclipsed Richard Lavery Institut de Biologie Physico-Chimique, Paris

65. Favoured conformations gauche + trans gauche - Richard Lavery Institut de Biologie Physico-Chimique, Paris

66. Backbone dihedrals - II  :O3’ – P – O5’ – C5’g -  :P – O5’ – C5’ – C4’t  :O5’ – C5’ – C4’ – C3’g +  :C5’ – C4’ – C3’ – O3’g +  :C4’ – C3’ – O3’ – Pt  :C3’ – O3’ – P – O5’g -  (Y) : O4’ – C1’ – N1 – C2g -  (R) : O4’ – C1’ – N9 – C4 Richard Lavery Institut de Biologie Physico-Chimique, Paris

67. syn-anti glycosidic conformations Richard Lavery Institut de Biologie Physico-Chimique, Paris

68. Sugar ring puckering C5’ ENDO EXO Base Richard Lavery Institut de Biologie Physico-Chimique, Paris

69. Sugar pucker described as pseudorotation North : C3’-endo East : O4’-endo South : C3’-endo "2 B or not 2 B...." W. Shakespeare 1601

70. Pseudorotation Equations Altona et al. J. Am. Chem. Soc. 94, 1972, 8205 0 2 1 3 4 Base tan P = ( 4 - 1 ) - ( 3 - 0 ) 2 2 (Sin 36° + Sin72°) Amp = 2 / Cos P

71. Preferred sugar puckers Richard Lavery Institut de Biologie Physico-Chimique, Paris

72. Sugar pucker and P-P distance Richard Lavery Institut de Biologie Physico-Chimique, Paris

73. UNUSUAL DNA STRUCTURES

74. Alternative base pairs Watson-Crick Reversed Watson-Crick HoogsteenReversed Hoogsteen Richard Lavery Institut de Biologie Physico-Chimique, Paris

75. Watson-Crick + Hoogsteen = Base triplet - note C(N3) protonation Richard Lavery Institut de Biologie Physico-Chimique, Paris

76. Triple helix DNA Richard Lavery Institut de Biologie Physico-Chimique, Paris

77. Guanine Hoogsteen pairing  Base tetraplex Richard Lavery Institut de Biologie Physico-Chimique, Paris

78. Robert E Johnson et. al University of Texas Medical Branch Watson Crick vs Hoogsteen Hydrogen Bonding. (inset, G-C bonding also shown)

79. Quadruplex DNA Richard Lavery Institut de Biologie Physico-Chimique, Paris

80. Inverted repeat can lead to loop formation Richard Lavery Institut de Biologie Physico-Chimique, Paris

81. DNA cruciform Holliday junction Richard Lavery Institut de Biologie Physico-Chimique, Paris

82. PNA versus DNA Richard Lavery Institut de Biologie Physico-Chimique, Paris

83. Peptide Nucleic acid(PNA)  Achiral, peptide-like backbone  Backbone is uncharged  High thermal stability  High-specificity hybridization with DNA  Resistant to enzymatic degradation  Can displace DNA strand of duplex  Pyrimidine PNA strands can form 2:1 triplexes with ssDNA  Biotechnological applications Richard Lavery Institut de Biologie Physico-Chimique, Paris

84. Parallel-stranded DNA Richard Lavery Institut de Biologie Physico-Chimique, Paris

85. I-DNA: intercalated parallel-stranded duplexes Richard Lavery Institut de Biologie Physico-Chimique, Paris

86.  and  nucleotide anomers Richard Lavery Institut de Biologie Physico-Chimique, Paris

87. H  OH is not the only change in passing from DNA to RNA.... Richard Lavery Institut de Biologie Physico-Chimique, Paris

88. Biophysical properties of DNA

89. Facile denaturation (melting) and re-association of the duplex are important for DNA’s biological functions. In the laboratory, melting can be induced by heating. Hybridization techniques are based on the affinity of complementary DNA strands for each other. Duplex stability is affected by DNA length, % GC base pairs, ionic strength, the presence of organic solvents, pH Negative charge – can be separated by gel electrophoresis T° Single strands duplex Natalia Tretyakova College of Pharmacy, U. of Minnesota

90. Separation of DNA fragments by PAGE DNA strands are negatively charged. Migrate towards the (+) electrode (anode) Migration time ~ ln ( number of base pairs)

91. Books on DNA Principles of Nucleic Acid Structure, W. Saenger, 1984 Springer-Verlag Nucleic Acid Structure, Ed. S. Neidle, 1999 Oxford University Press DNA Structure and Function, R.R. Sinden, 1994 Academic Press Biochemistry, D. Voet and J.G. Voet, 1998 DeBoeck The Eighth Day of Creation, H.F. Judson, 1996 Cold Spring Harbour Press Richard Lavery Institut de Biologie Physico-Chimique, Paris

92. HISTORY of DNA

93. History of DNA 1865Gregor Mendel publishes his work on plant breeding with the notion of "genes" carrying transmissible characteristics 1869"Nuclein" is isolated by Johann Friedrich Miescher à Tübingen in the laboratory of Hoppe-Seyler 1892Meischer writes to his uncle "large biological molecules composed of small repeated chemical pieces could express a rich language in the same way as the letters of our alphabet" 1920Recognition of the chemical difference between DNA and RNA Phoebus Levene proposes the "tetranucleotide hypothesis" 1938William Astbury obtains the first diffraction patters of DNA fibres Richard Lavery Institut de Biologie Physico-Chimique, Paris

94. History of DNA 1944Oswald Avery (Rockefeller Institute) proves that DNA carries the genetic message by transforming bacteria Richard Lavery Institut de Biologie Physico-Chimique, Paris

95. History of DNA 1950Erwin Chargaff discovers A/G = T/C Richard Lavery Institut de Biologie Physico-Chimique, Paris

96. History of DNA 1953Watson and Crick propose the double helix as the structure of DNA based on the work of Erwin Chargaff, Jerry Donohue, Rosy Franklin and John Kendrew Richard Lavery Institut de Biologie Physico-Chimique, Paris

97. Maurice Wilkins – Kings College, London Richard Lavery Institut de Biologie Physico-Chimique, Paris

98. Watson-Crick model of DNA was based on X-ray diffraction picture of DNA fibres (Rosalind Franklin and Maurice Wilkins) Rosalind Franklin Natalia Tretyakova College of Pharmacy, U. of Minnesota

99. Rosalind Franklin (in Paris) Richard Lavery Institut de Biologie Physico-Chimique, Paris

100. X-ray fibre diffraction pattern of B-DNA Richard Lavery Institut de Biologie Physico-Chimique, Paris

101. Linus Pauling’s DNA Richard Lavery Institut de Biologie Physico-Chimique, Paris

102. DNA secondary structure – double helix James Watson and Francis Crick, 1953- proposed a model for DNA structure DNA is the molecule of heredity (O.Avery, 1944) X-ray diffraction (R.Franklin and M. Wilkins) E. Chargaff (1940s) G = C and A = T in DNA Francis CrickJim Watson Natalia Tretyakova College of Pharmacy, U. of Minnesota

103. Watson and Crick Richard Lavery Institut de Biologie Physico-Chimique, Paris

104. It has not escaped our notice … It has not escaped our notice that the specific pairing we have postulated suggests a possible copying mechanism for the genetic material. Richard Lavery Institut de Biologie Physico-Chimique, Paris

105. Double helix ? Richard Lavery Institut de Biologie Physico-Chimique, Paris

106. transcription translation DNA replication (deoxyribonucleic acids) (ribonucleic acids) Natalia Tretyakova College of Pharmacy, U. of Minnesota

107. Dickerson Dodecamer (Oct. 1980) Richard Lavery Institut de Biologie Physico-Chimique, Paris