Presentation is loading. Please wait.

Presentation is loading. Please wait.

Cystic fibrosis the most common autosomal recessive (AR) disorder among Caucasians, carriers of cystic fibrosis are not affected by the disease carrier.

Similar presentations


Presentation on theme: "Cystic fibrosis the most common autosomal recessive (AR) disorder among Caucasians, carriers of cystic fibrosis are not affected by the disease carrier."— Presentation transcript:

1 Cystic fibrosis the most common autosomal recessive (AR) disorder among Caucasians, carriers of cystic fibrosis are not affected by the disease carrier frequency - 1 in 25 individuals of Northern European descent –ethnic variability –affecting both males and females equally CFTR - cystic fibrosis transmembrane conductance regulator gene, localized on chromosome 7 mutation in the CFTR gene CFTR encodes a chloride channel; transport of chloride ions across plasma membrane of epithelial cells that line the lung airways, pancreas, sweat glands, and other tissues disorder of epithelial ion transport

2 Disease chronic and progressive disease pulmonary disease – damage to the lungs because of accumulation of thick mucus, improper function of water secretion and its cleaning function, breathing difficulties, frequent resp. infections, permanent lung damage –Viscous mucus in the lungs – chronic airway infection (pneumonia, Pseudomonas, Cephacia) –Damage to lungs shortens life expectancy – 30 - 40 years digestive system –pancreatic secretion – leading to digestion problems, malabsorption of proteins and fats, retained enzymes causes fibrosis –liver – plugging of small bile ducts, cirrhosis –meconium ileus – intestinal obstruction (15-20% CF babies) reproductive system –improper formation of the vas deferens leading to male sterility sweat glands –uptake of chloride from sweat ducts – absence of functional CFTR causes increased sodium chloride content, excess salt loss

3 NBD -nucleotide binding domains (ATP) R NBD1 NBD2 TM1 TM2 Cl - cAMP-regulated chloride channel transport of chloride ions across plasma membrane of epithelial cells (lungs, pancreas, sweat glands, and other tissues) mutations in the CFTR gene R -regulation domain (cAMPdep.) TM – transmembrane spanning domains lumen cytoplasm CFTR protein - cystic fibrosis transmembrane conductance regulator Molecular causation of CF

4 There is one the most commonly inherited allele which is known to cause up to 70% of all cystic fibrosis cases. This mutation is called the delta – F508 mutation Δ F508 allele has 3 nucleotides deletion, which code for the amino acid phenylalanine (F) in the 508 position of the amino acid sequence of the chloride transporter There are twelve other common mutations with a combined frequency of ~15% (in total 1967 mutations, http://www.genet.sickkids.on.ca/cftr/StatisticsPage.html) Reverse hybridization kit (34 mutation) – detects about 91% of patients of Czech origin CFTR mutations

5

6 Mutation in the CFTRgene Mutation in the CFTR gene germinal mutations somatic mutations have not been described so far de novo mutation – rarely distribution of mutation shown population specificity

7 Hemochromatosis autosomal recessive disease affecting iron metabolism, carrier frequency - 1 in 15 individuals (Czech population), incomplete penetrance excessive iron absorption, its deposition in organs (mainly parenchymal) and subsequent damage of the organism hepatopathy (cirrhosis, hepatocellular carcinoma) diabetes mellitus, arthropathy, hypogonadism, kardiomyopathy, amenorhea serum iron, transferrin saturation, ferritin, liver biopsy repeated phlebotomy

8 HFE gene mutations

9 RFLP Restriction Fragment Length Polymorphism restriction analysis of DNA by its digestion with restriction endonucleases (RE) in specific restriction sites in the case the sequence difference (polymorphism) creates or disturbs a specific site for RE, after restriction, fragments with different sizes are formed

10 RFLP Restriction Fragment Length Polymorphism Restriction endonucleases (RE) –known about 2100 bacterial RE –RE recognize variously short nucleotides sequences (4,6,8), in which then they digest covalent phosphodiester bonds Principle of the analysis –starting DNA (genomic DNA, PCR product) –digestion with a restriction enzyme into fragments with different sizes –fragments electrophoresis separation

11 Sequence of C282Y mutation (hemochromatosis) 5´- TGGCAAGGGTAAACAGATCCctctcctcatccttcctctttcctgtcaagtgccctcctttggtgaaggtgacacatcatgtgacctcttca g tgaccac a ctacggtgtcgggccttgaactactacccccagaacatcaccatgaagtggctgaaggataagcagccaatggatgccaaggagttcgaac c taaagacgtattgcccaatggggatgggacctaccagggctggataaccttggctGTACcccctggggaagagcagagatatacGT G Ccaggtgg a gcacccaggcctggatcagcccctcattgtgatctggggtatgtgactgatgagagccaggagctgagaaaatctattgggGGTTGAGAGGA G TGC CTGAGgaggtaattatggcagtgagatgaggatctgctctttgttagggggtgggctgagggtggcaatcaaaggctttaacttgctttttctgttttagagccctca ccgtctggcaccctagtcattggagtcatcagtgga – 3´ Primers restriction endonucleasis RsaI restriction site (GTAC) mutation C282Y (GTGC → GTAC)

12

13 RFLP – mutation C282Y - ELFO

14 RFLP – mutation C282Y+H63D (hemochromatosis) MIX – per 1 sample 17 ul H 2 O 2 ul buffer 10 ul PCR product 1 ul restriction endonuclease (add on ice) C282Y: restriction endonuclease RsaI H63D: restriction endonuclease BclI

15 Mutation C282Y (v bp) Healthy homozygote: 250140 Homozygote with mutation: 250 111 Heterozygote: 250140111 Evaluation of the results of the RFLP analysis

16 Mutation H63D (v bp) Healthy homozygote:13870 Homozygote with mutation:208 Heterozygote:20813870 Evaluation of the results of the RFLP analysis

17 Detection of ΔF508 mutation in CFTR gene This technique depends on the specificity of PCR primers ASO-PCR: 3 primers are made: General primer (G) Specific primer to normal sequence (N) Specific primer to mutated sequence (M) M G TARGET SEQUENCE N X

18 C/N C/M 121212 Homozygous No Mutation Heterozygous Carrier Homozygous for Mutation PCR reaction is performed in 2 tubes: PCR mix M0 contains primer G and primer N PCR mix M1 contains primer G and primer M

19 PCR – deltaF508 (cystic fibrosis) PCR mix 0: water8,5 µl buffer2,0 µl dNTP mix4,0 µl MgCl 2 2,0 µl primers M01,2 µl DNA2,0 µl Taq polymerase0,4 µl (on ice) PCR mix 1: water8,5 µl buffer2,0 µl dNTP mix4,0 µl MgCl 2 2,0 µl primers M11,2 µl DNA2,0 µl Taq polymerase0,4 µl (on ice)

20 PCR product for CFTR gene (ΔF508) PCR product for control gene Unutilized PCR chemicals (may not always be visible) M0 M1 healthy homozygote with mutation heterozygote Evaluation of the results of the CFTR gene analysis Mutation ΔF508 detection contingent upon the cystic fibrosis Allele specific PCR + gel electrophoresis M0 – PCR reaction detects non-mutated allele M1 – PCR reaction detects mutated allele


Download ppt "Cystic fibrosis the most common autosomal recessive (AR) disorder among Caucasians, carriers of cystic fibrosis are not affected by the disease carrier."

Similar presentations


Ads by Google