1. Section H Cloning Vectors
Molecular Biology Course
Section H
Cloning Vectors

2. vectors Cloning vectors: to clone a gene in a vector
Introduction
vectors
Cloning vectors:
to clone a gene in a vector
Expression vectors:
allowing the exogenous DNA to be inserted, stored, and manipulated mainly at DNA level
Integration vectors:
allowing the exogenous DNA to be inserted, stored, and expressed.

3. H2 Bacteriophage vectors H3 Cosmids and YACs H4 Eukaryotic vectors
Cloning vectors
H1 Plasmid vecters
H2 Bacteriophage vectors
H3 Cosmids and YACs
H4 Eukaryotic vectors

4. H1 Design of Plasmid Vectors
Cloning vectors
H1 Design of Plasmid Vectors
H1-1 A plasmid vector for cloning
H1-2 A plasmid vector for gene expression

5. H1-1 A plasmid vector for cloning
H1 Design of Plasmid Vectors
H1-1 A plasmid vector for cloning
autonomously replicating independent of host’s genome.
Easily to be isolated from the host cell. (Plasmid preparation)
Selective markers: Selection of cells
(1) Containing vector: one marker is enough (2) Containing ligation products:
# twin antibiotic resistance
# blue-white screening
4. Contains a multiple cloning site (MCS)

6. Ampicillin resistant? yes yes Tetracycline resistant? No yes
Screening by insertional inactivation of a resistance gene
Ampr
Tcr
ori
pBR322
B X B B
Tcr
Ampr
Ampr X B
ori
ori
Ampicillin resistant? yes yes
Tetracycline resistant? No yes

7. H1 Design of Plasmid Vectors
Replica plating: transfer of the colonies from one plate to another using absorbent pad or Velvet (绒布).
transfer of colonies
+ampicillin
+ ampicillin
+ tetracycline
these colonies have bacteria with recombinant plasmid

8. H1 Design of Plasmid Vectors

9. Blue white screening H1 Design of Plasmid Vectors Lac promoter Ampr
Screening by insertional inactivation of the lacZ gene
Lac promoter
MCS (Multiple cloning sites,
多科隆位点）
Ampr
pUC18
(3 kb)
lacZ’
ori
The insertion of a DNA fragment interrupts the ORF of lacZ’ gene, resulting in non-functional gene product that can not digest its substrate x-gal.

10. H1 Design of Plasmid Vectors lacZ encode enzyme b-galactosidase
lac promoter
(substrate of the enzyme)
X-gal
IPTG
Blue product
The expression of active b-galactosidase has to be vector dependent for the selection purpose
lacZ’: a shortened derivative of lacZ,
encoding N-terminal a-peptide of b-galactosidase.
Host strain for vectors containing lacZ’:
contains a mutant gene encoding only the C-terminal portion of b-galactosidase which can then complement the a-peptide to produce the active enzyme

11. H1 Design of Plasmid Vectors
Recreated vector: blue transformants
Recombinant plasmid: containing inserted DNA: white transformants
Recreated vector (no insert)
Recombinant plasmid (contain insert)

12. Multiple cloning sites
H1 Design of Plasmid Vectors
Multiple cloning sites
Multiple restriction sites enable the convenient insertion of target DNA into a vector
Ampr
ori
pUC18
(3 kb)
MCS (Multiple cloning sites,
多科隆位点）
Lac promoter
lacZ’
…ACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCA…
. T h rA s n S er S e r Val Pro Gly Asp Pro Leu Glu Ser Thr Cys Arg His Ala Ser…
EcoRI
SacI
KpnI
SmaI
XmaI
BamHI
XbaI
SalI
HincII
AccI
PstI
SphI
Lac Z

13. H1-2 A plasmid vector for gene expression
H1 Design of Plasmid Vectors
H1-2 A plasmid vector for gene expression
Expression vectors: allowing the exogenous DNA to be inserted, stored and expressed.
Promoter and terminator for RNA transcription are required.
Intact ORF and ribosomal binding sites (RBS) are required for translation.

14. Some cloning vector can be used to transcribe a gene. (pUC vectors)
H1 Design of Plasmid Vectors
Some cloning vector can be used to transcribe a gene. (pUC vectors)
Special transcriptional vectors: pGEM series containing promoters from bacteriophages T7 and SP6 for in vitro transcription with the corresponding polymerases.
Expression vector (transcription & translation).

15. H1 Design of Plasmid Vectors
Ampr
ori
pUC18
(3 kb)
MCS (Multiple cloning sites,
多科隆位点）
Lac promoter
lacZ’
The ORF of the inserted gene has to be in the same direction as that of the lacZ
A fusion protein contains the N-terminal sequence of lacZ and the inserted ORF will be produced

16. (transcription & translation).
H1 Design of Plasmid Vectors
Expression vector
(transcription & translation).
Promoters
lacUV-5: a mutant lac promoter which is independent of cAMP receptor protein. (constitutive expression)
lPL promoter
Phage T7 promoter
Fused proteins
Individual proteins

17. T7 expression vector H1 Design of Plasmid Vectors T7 promoter RBS
Start codon
MCS
Ampr
Transcription terminator
T7 expression vector
ori

18. Fused proteins Lac fusions: (discussed)
H1 Design of Plasmid Vectors
Fused proteins
Lac fusions: (discussed)
His-tag fusions: A sequence encodes His-tag was inserted at the N- terminus of the target ORF, which allows purification of the fusion protein to be purified by binding to Ni2+ column.

19. H2 Bacteriophage vector
Cloning vectors
H2 Bacteriophage vector
Tow examples:
H2-1 λ phage
bacteriophageλ
λ replacement vector
H2-2 M13 phage
M13 phage vector
Cloning in M13
Hybrid plasmid-M13 vectors

20. λ phage H2 Bacteriophage vector viruses that can infect bacteria.
48.5 kb in length
Linear or circular genome (cos ends)
Lytic phase (Replicate and release)
Lysogenic phase (integrate into host genome)

21. H2-1λ phage H2 Bacteriophage vector cos cos Exogenous DNA (~20-23 kb)
Protein coat
DNA
Long (left)
arm
short (right)
arm
cos
Nonessential region
cos
Exogenous DNA
(~20-23 kb)

22. The phage λ cos ends H2 Bacteriophage vector 5‘-CGGGGCGGCGACCTCG-3’
3’-GCCCCGCCGCTGGAGC-5’
Cleavage Ligation
(during packaging) (after infection)
GGGCGGGCGACCTCG-3’
5’-CG GC-5’
3’-GCCCCGCCGCTGGA
Circular form
Linear form

23. H2 Bacteriophage vector

24. H2 Bacteriophage vector
λ replacement vector
Replace the nonessential region of the phage genome with exogenous DNA (~ 20 kb)
high transformation efficiency (1000-time higher than plasmid)

25. H2 Bacteriophage vector
λ replacement vector
2. Packing with a mixture of the phage coat proteins and phage DNA-processing enzymes
Ligation
3. Infection and formation of plaques

26. H2 Bacteriophage vector
Plaques: the clear areas within the lawn where lysis and re-infection have prevented the cells from growing.
Recombinant l DNA may be purified from phage particles from plaques or from liquid culture.

27. lysogens in cloning techniques
H2 Bacteriophage vector
lysogens
in cloning techniques
Genes or foreign sequences may be incorporated essentially permanently into the genome of E.coli by integration of a  vector containing the sequence of interest.

28. H2-2 M13 phage H2 Bacteriophage vector A filamentous phage
Phage particles contain a 6.7kb circular single strand of DNA.
After infection of a sensitive E.coli host,the complementary strand is synthesized,and the DNA replicated as a double-stranded circle,the replicative form(RF) with about 100 copies per cell.
Contrasting to phage ,the cell are not lysed by M13,but continue to grow slowly,and single-stranded forms are continuously packaged and released from the cells as new phage particles.

29. M13 phage vectors H2 Bacteriophage vector
Replication form (RF, dsDNA) of M13 phage can be purified and manipulated like a plamid.
Phage particles (ssDNA): DNA can be isolated in a single-stranded form
DNA sequencing (Topic J2)
Site-directed mutagenesis (Topic J5)
Cloning (RF, like plasmid)  transfection (recombinant DNA)  growth (plating on a cell lawn)  plaques formation (slow growth)

30. Blue-white selection

31. Hybrid plasmid-M13 vectors
H2 Bacteriophage vector
Hybrid plasmid-M13 vectors
Small plasmid vectors (pBluescript) being developed to incorporate M13 functionality
Contain both the plasmid and M13 origin of replication
Normally propagate as true plasmids
Can be induced to form single-stranded phage particles by infection of the host cell with a helper phage.

32. H3 Cosmids and YACs H3-1 Cloning large DNA fragments （> 20 kb)
Cloning vectors
H3 Cosmids and YACs
H3-1 Cloning large DNA fragments （> 20 kb)
H3-2 Cosmid vectors
H3-3 YAC vectors
H3-4 Selection in S. cerevisiae (啤酒酵母）

33. H3-1 Cloning large DNA fragments
H3 Cosmids and YACs
H3-1 Cloning large DNA fragments
(Eukaryotic Genome project)
Analysis of eukaryotic genes and the genome organization of eukaryotes requires vectors with a larger capacity for cloned DNA than plasmids or phage .
Human genome (3 x 109 bp): large genome and large gene demand vectors with a large size capacity.

34. H3 Cosmids and YACs
H3-2 Cosmid vectors
Utilizing the properties of the phage l cos sites in a plasmid vector.
A combination of the plasmid vector and the COS site which allows the target DNA to be inserted into the l head.
The insert can be kb.

35. Formation of a cosmid clone
Digestion
Ligation
C) Packaging and infect

36. Cloning in a cosmid vector
H3 Cosmids and YACs B
cos
SmaI
Cloning in a cosmid vector S B B S
cos
cos B
cos B

37. H3-3YAC vectors H3 Cosmids and YACs
Can accommodate genomic DNA fragments of more than 1 Mb, and can be used to clone the entire human genome, but not good in mapping and analysis
Essential components of YAC vectors :
Centromers (CEN), telomeres (TEL) and autonomous replicating sequence (ARS) for proliferation in the host cell.
ampr for selective amplification and markers such as TRP1 and URA3 for identifying cells containing the YAC vector in yeast cells.
Recognition sites of restriction enzymes (e.g., EcoRI and BamHI)

38. H3 Cosmids and YACs
Yeast selection

39. Cloning in YAC vector H3 Cosmids and YACs SnaB CEN4 ARS TRP1 SUP4:
insertion site for red-white selection
SUP4:
CEN4
ARS
TRP1
Cloning in YAC vector
TEL B
B TEL
Digest with BamHI/SnaI
Ligate with blunt ends
Transfect into yeast

40. H3-4 Selection in S.cerevisiae
H3 Cosmids and YACs
H3-4 Selection in S.cerevisiae
Saccharomyces cerevisiae selectable markers do not confer resistance to toxic substances
Growth of yeast on selective media lacking specific nutrients can serve for selection. Auxotrophic yeast mutants (营养缺欠型) are made as host strains for plasmids containing the genes complementary to the growth defect .
For example: TRP1 mutants can’t make tryptophan, and can only grow on media supplemented with tryptophan. The presence of a plasmid containing gene encoding tryptophane enables the cell to grow on media without tryptophan.

41. H4 Eukaryotic Vectors Transfection of eukarotic cells Shuttle vectors
Cloning vectors
H4 Eukaryotic Vectors
Transfection of eukarotic cells
Shuttle vectors
H4-1 Yeast episomal plasmids (Yeasts)
H4-2 Agrobacterium tumefaciens (农杆菌) Ti plasmid (Plants)
H4-3 Baculovirus (Insects)
H4-4 Mammalian viral vectors (Mammalian)

42. Transfection: more problematic than bacterial transformation
H4 Eukaryotic Vectors
Transfection:
The take-up of DNA into eukaryotic cells
more problematic than bacterial transformation
Much lower efficiency in the progress
Transfection methods
Electroporation
Microinjection
liposome

43. H4 Eukaryotic Vectors
Shuttle vectors
Vectors contain sequences required for replication and selection in both E. coli and the desired host cells, so that the construction and many other manipulation of the recombinant plasmids can be completed in E. coli.
Most of the eukaryotic vectors are constructed as shuttle vectors

44. H4 Eukaryotic Vectors
A Shuttle vector
MCS

45. H4-1 Yeast episomal plasmids (YEps)
H4 Eukaryotic Vectors
H4-1 Yeast episomal plasmids (YEps)
Vectors for the cloning and expression of genes in Saccharomyces cerevisiae.
Based on 2 micron (2m) plasmid which is 6 kb in length.
One origin
Two genes involved in replication
A site-specific recombination protein FLP, homologous to l Int.
2. Normally replicate as plasmids, and may integrate into the yeast genome.

46. H4 Eukaryotic Vectors
A YEp vector
MCS
Insert Figure 1

47. YEp vector H4 Eukaryotic Vectors Replicate as plasmid from 2m origin
integrate by recombinantion

48. H4-2 Agrobacterium tumefaciens Ti plasmid
H4 Eukaryotic Vectors
H4-2 Agrobacterium tumefaciens Ti plasmid
Ti plasmid
200kb
T-DNA
plant chromosome
Integrated T-DNA
Gene induce crown gall

49. H4 Eukaryotic Vectors
crown gall or tumor

50. Recombinant Ti plasmid
H4 Eukaryotic Vectors
Recombinant Ti plasmid
Place the target gene in the T-DNA region of a Ti plasmid, then transform the recombinant Ti plasmid. (WT is not good because of the crown gall formation)
Recombinant T-DNA transformed into the A. tumefaciens cell carrying a modified Ti plasmid without T-DNA (T-DNA that are responsible for crown gall formation. The deleted T-DNA is called disarmed T-DNA shuttle vector).

51. H4 Eukaryotic Vectors
Plant gene engineering using T-DNA vector

52. H4-3 Baculovirus Infects insect cells
H4 Eukaryotic Vectors
H4-3 Baculovirus
Infects insect cells
The strong promoter expressing polyhedrin protein can be used to over-express foreign genes engineered. Thus, large quantities of proteins can be produced in infected insect cells.
Insect expression system is an important eukaryotic expression system.

53. H4-4 Mammalian viral vectors
H4 Eukaryotic Vectors
H4-4 Mammalian viral vectors
SV40: 5.2 kb, can pack DNA fragment similar to phage l.
Retroviruss:
single-stranded RNA genome, which copy to dsDNA after infection.
Have some strong promoters for gene expression
Gene therapy

54. H4 Eukaryotic Vectors
Gene transfer
Genes may be transiently or permanently introduced into cultured eukaryotic cells without the use of vector in strict sense.
Transient expression
Integration