1. Genetics News EditBase Mystery Sequence EditBase format Pure text format Problem Set 4

2. Study Question 3 What is the minimum number of bases to specify the number of different amino acids found in protein? G A C T 1 base fixed length nonoverlapping

3. Study Question 3 What is the minimum number of bases to specify the number of different amino acids found in protein? 2 base, fixed length, nonoverlapping

4. Study Question 3 What is the minimum number of bases to specify the number of different amino acids found in protein? 3 base, fixed length, nonoverlapping

5. Growth of E. coli on a plate

12. Infection by phage T4

15. Growth of E. coli B + phage T4 Seed plate with E.coli B and phage T4 (not visible)

16. Growth of E. coli B + phage T4

21. rII region of phage T4 rII T4 rII + T4 rII - T4 DNA rIIA rIIBrIIA - rIIB

22. Distinguishing T4 rII + from rII - T4 rII + T4 rII - E. coli B x T4 rII + T4 rII - E. coli K( ) x T4 rII - cannot grow on E. coli K( )

23. Why is T4rII - defective? T4 rII - T4 rII + E. coli K( ) No infection Lysis

24. Crick et al frameshift experiment rIIA - rIIA + proflavin

25. How to explain frameshift results? Role of proflavin in experiment CACTCGGATACACTCGGATA C A C T C G ?? G A T A GTGAGCGTGAGC GTGAGCACGTGAGCAC Proflavin causes one base insertions (or deletions)

26. How to explain frameshift results? Wild type rIIA rIIA + … THE FAT CAT ATE THE BIG RAT... Wld type rIIA

27. How to explain frameshift results? Single frameshift rIIA - THE FAT CAR TAT ETH EBI GRA … … THE FAT CAT ATE THE BIG RAT...

28. How to explain frameshift results? Double frameshift rIIA - … THE FAT CAR TAT ETH EBI GRA … … THE FAT CAT ATE THE BIG RAT... … THE FAT CAR TAR TET HEB IGR …

29. How to explain frameshift results? Triple frameshift rIIA - … THE FAT CAR TAT ETH EBI GRA … … THE FAT CAT ATE THE BIG RAT... … THE FAT CAR TAR TET HEB IGR … … THE FAT CAR TAR TOE THE BIG...

30. Study Question 7 When will proflavin-induced mutation suppress?

31. Study Question 8 Results of frameshift experiment if variable length code? This is a variable length code This is a varitable length code Variable length code with GATC?