Presentation is loading. Please wait.

Presentation is loading. Please wait.

JGI Timeline 1997 JGI April 2003 Human Genome Program Officially Ended Human Genome Program Officially Launched 1990 Joint Genome Institute ………………….(JGI)

Similar presentations


Presentation on theme: "JGI Timeline 1997 JGI April 2003 Human Genome Program Officially Ended Human Genome Program Officially Launched 1990 Joint Genome Institute ………………….(JGI)"— Presentation transcript:

1 JGI Timeline 1997 JGI April 2003 Human Genome Program Officially Ended Human Genome Program Officially Launched 1990 Joint Genome Institute ………………….(JGI) 5 19 16 Non Traditional User Facility

2 US DOE Joint Genome Institute The JGI Post Human Genome Project Community Sequencing Program (CSP) Microbial Community Genomics

3

4 Overview The Community Sequencing Program (CSP) To provide the scientific community through a peer reviewed process access to high throughput sequencing at the JGI.

5 What types of projects will the JGI/CSP accept? A wide range of projects. Ultimately, the most important factor in determining if a project will be accepted is its scientific merit. User Guide > How to Propose a Project

6 JGI Director Users Proposal Study Panel Scientific Advisory Committee Sequence Allocation Designated Lab Director Proposals & Peer Review Process General Scientific Users Proposals

7 FAQ What can researchers get from the CSP program? The deliverables can range from raw sequence traces to well-annotated assembled genomes depending on the request in the proposal.

8 Users Scientific Support for Approved Projects Scientific Support Group SSG Production Sequencing Informatic Analysis Of Sequence Interactions of the JGI and Scientific Users with Approved Sequencing Proposals

9 DOE Gov Agencies Scientific Support for Approved Projects Scientific Support Group SSG Production Sequencing Informatic Analysis Of Sequence Interactions of the JGI and Scientific Users with Approved Sequencing Proposals (EPA,USDA, NSF) GTL, Microbe CSP

10 DOE Informatics JGI Science Programs Production Sequencing

11 DOE+CSP+Gov A Informatics JGI Science Programs Scientific Support Group Production Sequencing

12 Sequence Based Science at the JGI Gene Regulatory Vocabulary of Animals Studies of Body Plan Evolution Microbial Community Genomics

13 < 1% of microbes are culturable Many unculturables live in interdependent consortia of considerable diversity Aim: to recover genome-scale sequences and reveal metabolic capabilities What is the structure of natural microbial populations? What is a microbial species? Can we harness their metabolic capabilities

14 What Enviroments to Study? Ones with minimal microbial complexity

15 Iron Mountain Jill Banfield et al. UC Berkeley JillBanfieldGene Tyson Phil Hugenholtz UC Berkeley Geology

16 Iron Mountain Superfund site Discharging >1 ton of toxic metals/day (pH <1) FeS 2

17 “whole metagenome shotgun” dataset

18 Purify High Molecular Weight DNA Shotgun Library Construction DNA Sequencing Fosmid Library Construction Fosmid Insert End Sequencing Assembly Annotation ===== === == = ===== === == = = = = ===== === == = = ===== === == = Enviromental Sample

19 Purify High Molecular Weight DNA DNA Sequencing Fosmid Library Construction Fosmid Insert End Sequencing Assembly Annotation ===== === == = = = ===== === == = = = Shotgun Library Construction ===== === == = ===== === == = Shotgun Library Construction ===== === == = ===== === == = = When possible culture isolates = ? Enviromental Sample

20 Iron Mtn “whole metagenome shotgun” GC content separates into two components Forward read average G+C Reverse read average G+C archaea bacteria

21 Iron Mountain “whole metagenome shotgun” GC and depth distributions Read average G+C 0.55 0.38 Read depth 310 Bacterial Lepto II Lepto III

22 Archaeal Fer 2 Fer 1 (cultured and sequenced ) G-plasma Read average G+C 0.55 0.38 310 Bacterial Lepto II Lepto III 310 Read depth

23 Archaeal Fer 2 (3X) Fer 1 (1X) G-plasma (1X) Read average G+C 0.55 0.38 310 Bacterial Lepto II (3X) Lepto III (1X) 310 Stoichiometry Read depth

24 Archaeal Fer 2 Fer 1 G-plasma Read average G+C 0.55 0.38 310 Bacterial Lepto II Lepto III 310 Other sampled genomes at low depth (including eukaryotes) 15% of reads

25 Similarity to Fer1 (isolate) to Sequence in Community %id to cultivated Fer1 isolate Number of reads 64.9% 78.2% 98-100%.50.60.70.80 1..90 Fer2 G plasma Fer1 Mixed Community Reads

26 Conclusions So Far The stochiometry of organisms encouraging for the assembly of individual genomes Assemblies support 16S studies suggesting limited diversity Isolated Fer1 genome sequences matches genome in environmental sample

27 How do we know that our assembly is correct?

28 How do you know you’ve done it right? Check pair ends against scaffold At the gross level: check pairs (expect few % due to failing/chimeric clones) Align all reads back against assembled scaffolds scaffolds end where there is no clone coverage in 3kb plasmids Identifies potentially repetitive areas and/or rearrangements How do we know that our assembly is correct?

29 Fer2 vs. fer1 shows local synteny Fer1 and Fer2 have avg. nt identity of 78% Fer1 gene on contig Fer2 gene on contig

30 What does it mean to assemble a community genome? Sample derived from millions of genomes. ? What is a “species” in the enviroment? Members of the same species a)significantly different (many lineages survive and diverge) b)highly similar (selective sweeps)

31 What does it mean to assemble a community genome? Lepto II : 1 nucleotide variation / 3,000 bp Fer II: 2.2 nucleotide variation / 100 bp

32 1 CONSENSUS 130953 gtttatattaaatccattgatttctaagcttccggttcttcttccgtataatggagattt 131012 XYG46314.b1 162 A.......C........................A...........A.............. 103 XYG44123.b1 673 A.......C........................A...........A.............. 732 XYG44918.b1 48 A.......C........................A........... 4 XYG13291.g3 2.......... 11 XYG40116.g1 192......G..................................................... 133 XYG3051.b2 396......G..................................................... 455 CONSENSUS 131013 atagcttaataattcatcctccatcatacttatgcttgaacctgataatattatgtatag 131072 XYG46314.b1 102............................................................ 43 XYG44123.b1 733............................................................ 792 XYG13291.g3 12............................................................ 71 XYG40116.g1 132...A........................................................ 73 XYG3051.b2 456...A........................................................ 515 CONSENSUS 131073 ccttgtagtatccattaattcatcaaatattttctgcattatagatataataccatggtt 131132 XYG46314.b1 42.......................................... 1 XYG44123.b1 793........................ 816 XYG13291.g3 72............................................................ 131 XYG40116.g1 72 T............G....C....................A.................... 13 XYG3051.b2 516 T............G....C....................A.................... 575 5 Reads of the Same Sequence from 5 Different Members of the Same Species (FerII) 1 3 5 4 2 1 5 4 2 1 3

33 1 CONSENSUS 130953 gtttatattaaatccattgatttctaagcttccggttcttcttccgtataatggagattt 131012 XYG46314.b1 162 A.......C........................A...........A.............. 103 XYG44123.b1 673 A.......C........................A...........A.............. 732 XYG44918.b1 48 A.......C........................A........... 4 XYG13291.g3 2.......... 11 XYG40116.g1 192......G..................................................... 133 XYG3051.b2 396......G..................................................... 455 CONSENSUS 131013 atagcttaataattcatcctccatcatacttatgcttgaacctgataatattatgtatag 131072 XYG46314.b1 102............................................................ 43 XYG44123.b1 733............................................................ 792 XYG13291.g3 12............................................................ 71 XYG40116.g1 132...A........................................................ 73 XYG3051.b2 456...A........................................................ 515 CONSENSUS 131073 ccttgtagtatccattaattcatcaaatattttctgcattatagatataataccatggtt 131132 XYG46314.b1 42.......................................... 1 XYG44123.b1 793........................ 816 XYG13291.g3 72............................................................ 131 XYG40116.g1 72 T............G....C....................A.................... 13 XYG3051.b2 516 T............G....C....................A.................... 575 Two Haplotypes Among the 5 Different Members of the Same Species (FerII) 1 3 5 4 2 1 5 4 2 1 3

34 5 4 2 1 1 CONSENSUS 130953 gtttatattaaatccattgatttctaagcttccggttcttcttccgtataatggagattt 131012 XYG46314.b1 162 A.......C........................A...........A.............. 103 XYG44123.b1 673 A.......C........................A...........A.............. 732 XYG44918.b1 48 A.......C........................A........... 4 XYG13291.g3 2.......... 11 XYG40116.g1 192......G..................................................... 133 XYG3051.b2 396......G..................................................... 455 CONSENSUS 131013 atagcttaataattcatcctccatcatacttatgcttgaacctgataatattatgtatag 131072 XYG46314.b1 102............................................................ 43 XYG44123.b1 733............................................................ 792 XYG13291.g3 12............................................................ 71 XYG40116.g1 132...A........................................................ 73 XYG3051.b2 456...A........................................................ 515 CONSENSUS 131073 ccttgtagtatccattaattcatcaaatattttctgcattatagatataataccatggtt 131132 XYG46314.b1 42.......................................... 1 XYG44123.b1 793........................ 816 XYG13291.g3 72............................................................ 131 XYG40116.g1 72 T............G....C....................A.................... 13 XYG3051.b2 516 T............G....C....................A.................... 575 Two haplotypes Among the 5 Different Members of the Same Species (Fer II) 1 3 5 4 2 1 3

35 Polymorphisms occur in blocks Long quiet regions separate highly variable segments Variation is found in blocks of 5-10 genes Local depth % polymorphic sites ORFs

36 Summary of Iron Mountain Biofilm Limited number of predominant species present in biofilm the majority have never been cultured Several lines of evidence suggest that we can assemble genomes of these organisms Simplicity of community suggests removal of most variants by natural selection Now studying the metabolic capabilities of microbes

37


Download ppt "JGI Timeline 1997 JGI April 2003 Human Genome Program Officially Ended Human Genome Program Officially Launched 1990 Joint Genome Institute ………………….(JGI)"

Similar presentations


Ads by Google