Download presentation
Presentation is loading. Please wait.
Published byLea Fairweather Modified over 9 years ago
1
C4 long gene (20.4kb) C4 short gene (14.1kb) HERV-K(C4) Exon26, amino acids 1101-1106 C4B gene C4A gene 110111021103110411051106 PCPVLD GGGGGGACAACAGGTCACAATCTGCTG 110111021103110411051106 LSPVIH GAGGAGAGAAGAGGTCACTATGTAGTA STK19C4CYP21TNXB SNP rs3130342 [G/T] STK19C4 CYP21 TNXB TNXA STK19P STK19C4 CYP21 TNXA STK19P C4CYP21TNXB STK19P TNXA STK19C4 CYP21 TNXA STK19P C4CYP21 STK19P TNXA C4CYP21TNXB STK19P TNXA Supplementary Figure 1 a b Supplementary Figure 1 a The pattern of C4 CNV and the position of SNP rs3130342 were shown. This CNV region is reported to have variations of one, two, three or four repeats. Telomeric end is STK19 gene and centromeric end is TNXB gene. Within repeat sequence, C4 and CYP21 are multiplicated as complete genes, whereas STK19 and TNX were truncated to become pseudogenes, STK19P and TNXA, respectively. SNP rs3130342 is located at 5’-UTR of TNXB gene and is not included in the repeat sequence. b There are four major variants of C4 genes. Left figure shows that C4 long gene has insertion sequence named HERV-K(C4) in intron 9, whereas C4 short gene does not. C4A and C4B variants differ by only 4 amino acids at position 1101-1106, as shown in right figure.
2
Supplementary Figure 2 RP1-C4L RP1-C4S RP2-C4L RP2-C4S TNXB TNXA 2:22:32:12:2 2:12:2 2: 0: 0: 2 2: 0: 3: 02: 0: 1: 02: 0: 2: 02: 0: 0: 22: 0: 1: 1 2: 0: 0: 1 2: 0: 1: 1 123456789 RP1-C4L RP1-C4S RP2-C4L RP2-C4S b c y = -0.0316x + 0.02 R 2 = 0.0391 -0.6 -0.4 -0.2 0 0.2 0.4 0.6 0.8 -0.500.511.5 log ng of Genomic DNA CTCT R 2 = 0.996 0 0.5 1 1.5 2 2.5 00.511.522.5 Gene copy number (Southern) 2 - Ct (qPCR) a TNXB: TNXA
3
Supplementary table 1. Characteristics of cohorts a Age of onset for SLE patients, and age at drawing DNA samples for control patients. nFemaleAge a Case 19495.7%31.9 +/- 13.9 Case 28489.2%27.3 +/- 12.0 Case 320393.6%31.6 +/- 11.6 Control 153756.1%59.2+/-14.2 Control 236318.0%51.3+/-14.6 Control 329491.9%39.0+/-13.5 Supplementary table 2. Probes and primers for qPCR Target geneForward primerReverse primerTaqMan probe C4A 5’-GCA GGA GAC ATC TAA CTG GCT TCT-3’ 5’-CCG CAC CTG CAT GCT CCT-3’ 5’-FAM-ACCCCTGTCCAGTGTTAG-MGB-3’ C4B5’-FAM-ACCTCTCTCCAGTGATAC-MGB-3’ C4S5’-TTC CTT CAC TCC TCC AGT GGA-3’5’-AGT GGT TCC CTC CCA CAA GA-3’5’-FAM-ACAGACAGGAATAC-MGB-3’
4
Case Genotype Control Genotype Frequency of A allele Odds ratio a (95%CI) p value a nAAAGGGnAAAGGGCaseControl 1 st stage9458342537227246640.7980.6522.20 (1.37-3.56)0.000690 2 nd stage8351275363158170340.7770.6712.05 (1.23-3.47)0.00484 Total177109617899385416980.7880.6602.14 (1.52-3.03)5.18×10 -6 Supplementary table 3. Association of SNP rs1009382 from genome-wide study a Odds ratio of allele count model (A or G). b Fisher’s exact test of allele count model. Supplementary table 4. CNV analysis on female subgroup A B C4B012345Mean+/- SDP value a Control 2020450001.69+/-0.47 Case1, Case 23221079101.88+/-0.570.009377* C4234567Mean+/- SDP value a Control 20183610103.91+/-0.70 Case1, Case 211690241014.20+/-0.790.01059* a Results of Wilcoxon rank sum test comparing the copy numbers of Case1 and Case 2 with Control 2. The significant level alpha=0.025 for all the tests. * indicated p values below significant level.
5
Case Genotype Control Genotype Frequency of G allele Odds ratio a (95%CI) p value b nGGGTTTnGGGTTTCaseControl HLA-DRB1*1501(+) c 52484051411000.9620.9022.90 (0.76-13.6)0.092 HLA-DRB1*1501(-) d 123103191313203100100.9150.8082.78 (1.61-5.02)7.30x10 -5 Supplementary Table 5. Stratified analysis of rs3130342 with HLA-DRB1*1501 allele. a Odds ratio of recessive effect (GG or GT+TT). b Fisher’s exact test of recessive effect model. c Those who have at lease one HLA-DRB1*1501 allele. d Those who have no HLA-DRB1*1501 allele at either chromosome.
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.