1. 1

2. 2 1. DNA was dicovered by Juhann Friedrich in 1869 2. And the first demonstration that DNA contain genetic information was made in 1944 by Avery, Macleod and MacCary 3. 1951—Rosalind Franklin was showed or explained the —X-ray crystallography of DNA 4. 1953 Watson & Crick—explained complet stru. Of DNA

3. 3

4. 4

5. 5 1)DNA is composed of 2 chains of nucleotides that form a double helix shape. 2)The two strands are antiparallel. 3)The backbone of the DNA molecule is composed of alternating phosphate groups and sugars. 4)The complimentary nitrogenous bases form hydrogen bonds between the strands. 5)A is complimentary to T and G is complimentary to C. 6)The Diameter is 20 A(2nm) 7)The 2 polynucleotide chains are not identical but complimentary to each other. 8)The hydrogen bonds formed between purine and pyrimidine only. 9)The DNA is write handed double helix.

6. 6 Synthetic Nucleotide analogs & Chemotherapy Synthetic analogs of purines, pyrimidines, nucleosides, and nucleotides altered in either the heterocyclic ring or the sugar moiety. 1. The purine analog allopurinol, used in treatment of hyperuricemia and gout. 2. Cytarabine is used in chemotherapy of cancer. 3. Azathioprine is employed during organ transplantation to suppress immunologic rejection.

7. phenotype Protein DNA Gene Trait Gene 7

8. Genes & Proteins DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used to build cells and do much of the work inside cells Proteins are made of amino acids linked together by peptide bonds 20 different amino acids exist 8

9. 9

10. DNA Begins the Process DNA is found inside the nucleus Proteins, however, are made in the cytoplasm of cells by organelles called ribosomes Ribosomes may be free in the cytosol or attached to the surface of rough ER 10

11. Starting with DNA DNA ‘s code must be copied and taken to the cytosol DNA ‘s code must be copied and taken to the cytosol In the cytoplasm, this code must be read so amino acids can be assembled to make polypeptides (proteins) In the cytoplasm, this code must be read so amino acids can be assembled to make polypeptides (proteins) This process is called PROTEIN SYNTHESIS This process is called PROTEIN SYNTHESIS 11

12. RNA

13. Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 13

14. RNA Differs from DNA 14

15. Other Differences RNA contains the base uracil (U) RNA contains the base uracil (U) DNA has thymine (T) RNA molecule is single- stranded RNA molecule is single- stranded DNA is double- stranded 15 DNA

16. Three Types of RNA Messenger RNA (mRNA) copies DNA’s code & carries the genetic information to the ribosomes Messenger RNA (mRNA) copies DNA’s code & carries the genetic information to the ribosomes Ribosomal RNA (rRNA), along with protein, makes up the ribosomes Ribosomal RNA (rRNA), along with protein, makes up the ribosomes Transfer RNA (tRNA) transfers amino acids to the ribosomes where proteins are synthesized Transfer RNA (tRNA) transfers amino acids to the ribosomes where proteins are synthesized 16.

17. Messenger RNA Long Straight chain of Nucleotides Made in the Nucleus Copies DNA & leaves through nuclear pores Carries the information for a specific protein Carries the information for a specific protein Made up of 500 to 1000 nucleotides long Made up of 500 to 1000 nucleotides long Sequence of 3 bases called codon Sequence of 3 bases called codon AUG – methionine or start codon AUG – methionine or start codon UAA, UAG, or UGA – stop codons UAA, UAG, or UGA – stop codons 17

18. Ribosomal RNA (rRNA) rRNA is a single strand 100 to 3000 nucleotides long rRNA is a single strand 100 to 3000 nucleotides long Globular in shape Globular in shape Made inside the nucleus of a cell Made inside the nucleus of a cell Associates with proteins to form ribosomes Associates with proteins to form ribosomes Site of protein Synthesis Site of protein Synthesis 18

19. The Genetic Code A codon designates an amino acid An amino acid may have more than one codon There are 20 amino acids, but 64 possible codons Some codons tell the ribosome to stop translating 19

20. Name the Amino Acids AG? UCA? 20

21. Remember the Complementary Bases On DNA: A-T C-G On RNA: A-U C-G 21

22. Transfer RNA (tRNA) Clover-leaf shape Single stranded molecule with attachment site at one end for an amino acid Opposite end has three nucleotide bases called the anticodon 22

23. Codons and Anticodons The 3 bases of an anticodon are complementary to the 3 bases of a codon Example: Codon ACU Anticodon UGA 23 UGA ACU

24. Transcription and Translation

25. Transcription The process of copying the sequence of one strand of DNA, the template strand mRNA copies the template strand Requires the enzyme RNA Polymerase 25

26. Question:  What would be the complementary RNA strand for the following DNA sequence? DNA 5’-GCGTATG-3’ 26

27. Transcription Consists of three stages – Initiation: attachment of RNA Polymerase to the promotor region on DNA – Elongation: building of the mRNA from the 3’ end of the nucleotide polymer – Termination: release of RNA polymerase and mRNA following transcription of the terminator region of the DNA 27

28. 1. Initiation Genes on the DNA begin with a promoter region consisting of a sequence of A & T (TATA box) Transcription factors (proteins that assist the binding of RNA polymerase to the promoter) are found in association with the promoter region 28

29. Elongation Once initiation is complete the 2 strands of the DNA unwind due to the zipper region of the enzyme. RNA polymerase builds a mRNA strand complimentary to the DNA transcription unit. Once the RNA Polymerase passes the DNA strands reform their double helix 29

30. Termination In Eukaryotes The transcribed termination sequence, also known as the polyadenylation signal in the pre-mRNA, is AAUAAA. Polymerase continues to synthesize RNA until an enzyme catches up to it and causes it too fall off. 30

31. Transcribed mRNA (pre-mRNA) must be modified before leaving the nucleus modifications include: – addition guanine triphosphate cap to the 5” end of the mRNA Prevents “unraveling” Helps ribosome attach – addition of poly A tail to the 3’ end of the mRNA Prevents “unraveling” Assists in the export of mRNA from nucleus Modification of mRNA 31

32. 32 CAP Tail New Transcript Result of Transcription

33. How is this done? Small nuclear ribonucleicproteins (snRNP) recognize intron ends and together with proteins form a structure called a spliceosome Spliceosomes remove introns while connecting exons together 33

34. Why bother with introns? 1)Introns may regulate gene activity and the passage of mRNA into the cytoplasm 2)Genes may play roles in multiple proteins, introns may enable a gene to be diverse in function 3)May increase recombination of genetic material (easier to cut and paste) 34

35. 35

36. Translation A.Translation-forming of a polypeptide -uses mRNA as a template for a.a. sequence -steps (initiation, elongation, translocation and termination) -begins after mRNA enters cytoplasm -uses tRNA (the interpreter of mRNA)

37. B. Ribosomes -made of proteins and rRNA -each has a large and small subunit -each has three or two binding sites for tRNA on its surface -each has one binding site for mRNA -facilitates codon and anticodon bonding Translation

38. -The three tRNA binding sites are: 1. A site=holds tRNA that is carrying the next amino acid to be added 2. P site= holds tRNA that is carrying the growing polypeptide chain 3. E site= where discharged tRNAs leave the ribosome Translation

39. 39

40. – 61 of 64 codons code for a.a. – Codon AUG has two functions 1. codes for amino acid methionine (Met) 2. functions as a start codon – mRNA codon AUG starts translation – three codons act as stop codons (end translation) Translation

41. A. (Initiation) 1. Brings together mRNA, tRNA (w/ 1 st a.a.) and ribosomal subunits 2. Small ribosomal subunit binds to mRNA and an initiator tRNA -start codon= AUG - anticodon-UAC -small ribosomal subunit attaches to 5’ end of mRNA

42. -downstream from the 5’ end is the start codon AUG (mRNA) -the anticodon UAC carries the a.a. Methionine 3. After the union of mRNA, tRNA and small subunit, the large ribosomal subunit attaches. The intitiator tRNA and a.a. will sit in the P site of the large ribosomal subunit The A site will remain vacant and ready for the aminoacyl-tRNA

43. Translation (Initiation)

44. B. (Elongation) Amino acids are added one by one to the first amino acid (remember, the goal is to make a polypeptide) Step 1: Codon recognition mRNA codon in the A site forms hydrogen bonds with the tRNA anitcodon Step 2- Peptide bond formation The ribosome catalyzes the formation of the peptide bonds between the amino acids (the one already in place and the one being added) The polypeptide extending from the P site moves to the A site to attach to the new amino acid.

45. 1.The tRNA with the polypeptide chain in the A site is translocated to the P site 2.tRNA at the P site moves to the E site and leaves the ribosome 3.The ribosome moves down the mRNA in the 5’→3’ direction Translation (Translocation)

46. Initiation 46 mRNA AUGCUACUUCG 2-tRNA G aa2 AU A 1-tRNA UAC aa1 anticodon hydrogen bonds codon

47. 47 mRNA AUGCUACUUCG 1-tRNA2-tRNA UACG aa1 aa2 AU A anticodon hydrogen bonds codon peptide bond 3-tRNA GAA aa3 Elongation

48. 48 mRNA AUGCUACUUCG 1-tRNA 2-tRNA UAC G aa1 aa2 AU A peptide bond 3-tRNA GAA aa3 Ribosomes move over one codon (leaves)

49. 49 mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU

50. 50 mRNA AUGCUACUUCG 2-tRNA G aa1 aa2 AU A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU (leaves) Ribosomes move over one codon

51. 51 mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5

52. 52 mRNA GCUACUUCG aa1 aa2 A peptide bonds 3-tRNA GAA aa3 4-tRNA GCU aa4 ACU UGA 5-tRNA aa5 Ribosomes move over one codon

53. 53 mRNA ACAUGU aa1 aa2 U primarystructure of a protein aa3 200-tRNA aa4 UAG aa5 CU aa200 aa199 terminator or stop or stop codon codon Termination

54. End Product –The Protein! The end products of protein synthesis is a primary structure of a protein A sequence of amino acid bonded together by peptide bonds 54 aa1 aa2 aa3 aa4 aa5 aa200 aa199

55. Messenger RNA (mRNA) 55 methionineglycineserineisoleucineglycinealanine stop codon protein AUGGGCUCCAUCGGCGCAUAA mRNA start codon Primary structure of a protein aa1 aa2aa3aa4aa5aa6 peptide bonds codon 2codon 3codon 4codon 5codon 6codon 7codon 1

56. 56