1. Environmental DNA ‘eDNA’
Karen Mock & Torrey Rodgers
Utah State University

2. Noninvasive Genetic Sampling
eDNA is a noninvasive technique

3. Species Identification
Not individual ID
Presence/Absence Data
Assay designed to ID a particular species or group of species
Requires comparison with known reference sequences
Often a mitochondrial genome target sequence
e.g. CTATACGGGTCNGCCCTATTAGTCATTTTATCAT CATATTTCCAAGGTATTCTATTCCCTTCACCCAA CCGACTAATTAATAACCGCCTAGTCTCACTACAC AATGACTAGTACAACTAAATCAAAACAAATACG GAA
eDNA so far is just a species ID tool, not a tool for identifying individuals
Often mtDNA gene is used because mtDNA has a high copy number and there is a large amount of public sequence data available for mt genes.

4. Reference sequences are available, e. g
Reference sequences are available, e.g. from the Barcode of Life project and GenBank

5. eDNA
is DNA that can be extracted from environmental samples without capturing or even seeing the target organism.
DNA may be cellular or extracellular
Substrate may be water, snow, soil, vegetation…
Target may be single species, a small number of species, or everything present (meta-barcoding).

6. How it Works
Field Lab
Uses quantitative PCR (qPCR) to detect certain species; can be more sensitive and more specific than conventional PCR

7. Taxon-specific PCR primers and probe to detect a particular DNA sequence in a mixture of DNA molecules from different sources.

10. eDNA applications Species distribution
especially for rare, endangered, or cryptic species
Early detection of invasive species
Relative density

11. Species distributions
Especially useful for rare, endangered, or cryptic species
Species
Location
Citation
Rocky Mountain tailed frog
Idaho giant salamanders
Idaho
Goldberg et al. 2011
Pilliod et al. 2013
Eastern Hellbender
Indiana, Missouri, Ohio, Kentucky, North Carolina
Olsen et al. 2012
Santas et al. 2013
Spear et al. 2015
Bull Trout
Montana
Wilcox et al. 2013
Brook Trout
Massachusetts
Jane et al. 2014
Great Crested Newt
United Kingdom
Biggs et al. 2015
Weather Loach
Denmark
Sigsgaard et al. 2015
Cetaceans
Foote et al. 2014
Spadefoot Toad, Great Crested Newt, Weather Loach, White-faced darter,
Eurasian otter
Throughout Europe
Thomsen et al. 2002
Chinook Salmon
Upper Columbia River Basin
Laramie et al. 2015
Can be used in conjunction with occupancy modelling to calculate probability of detection (if sampling is repeated). Presents absence data can be used to model species distributions and habitat preferences

12. Invasive Species Detection
Early detection of invasive species before they become established
eDNA may be able to detect invasive species prior to traditional methods
Species
Location
Citation
Bighead Carp (Asian carp)
Great lakes region
Jerde et al. 2011, 2013
Mahon et al. 2013
Burmese Python
Florida
Piaggio et al. 2014
American Bull Frog
France
Dejean et al. 2012
New Zealand Mud Snail
Idaho
Goldberg et al. 2013
Zebra Mussel
Michigan
Egan et al. 2013
Bluegill
Japan
Takahara et al. 2013
Red Swamp Crayfish
Treguier et al. 2014
Didymo (Rock Snot)
New Zealand,
Western US
Cary et al. 2007
Mock, Rodgers, Olsen
Unpublished

13. Relative Density
The quantity of eDNA (from qPCR) in a sample should correlate with species biomass and thus density
Fig. 2 Combined scatter plots of eDNA shedding rate against biomass of fish in tanks.
Klymus et al. 2015

14. Relative Density eDNA vs. traditional kicknet surveys
Pilliod et al. 2013

15. Relative Density
In fish, eDNA shedding rates may vary with diet (Klymus et al. 2015)
More research needed to determine eDNA shedding rates, across species and environmental conditions
Such factors may bias the link between biomass and relative density
More empirical lab and field studies needed compare eDNA quantities and relative density

16. Sampling Considerations
eDNA persistence/degradation
Movement of eDNA in lotic systems
Cross contamination and false positives

17. eDNA persistence/degradation
In fresh water, eDNA degrades, and is no-longer detectable, in days or weeks (at longest 58 days, Strickler et al. 2015)
Thus eDNA detection should be indicative of contemporary species presence
How long eDNA persists in the environment after it is shed
Fig.1. Time-dependant changes in eDNA concentration after
fish removal . Maruyama et al 2014

18. eDNA persistence/degradation
eDNA degradation is influenced by temperature, UV and pH
Environments favorable for microbe activity increase rate of eDNA degradation (Strickler et al. 2015)
eDNA may persist much longer, (from months to hundreds of years) in aquatic sediments (Turner at al. 2015).

19. Movement of eDNA in lotic systems
In lotic systems, is eDNA detection indicative of local presence, or presence upstream instead?
Controlled experiment with caged trout
eDNA still detectable at 239m from cage site
Low flow 4-7 L/s
eDNA might become undetectable down stream due to dilution, settling of eDNA and cells, degradation over time as moving downstream. Likely dependent on flow
High flows >10 L/s
Jane et al. 2014

20. Movement of eDNA in lotic systems
In two invertebrate species, eDNA was detectable up to nearly 12 kilometers
from the source

21. Cross contamination
It is very important to avoid cross contamination in the field and lab to avoid false positives
Careful handling of samples (changing gloves between samples)
Bleach decontamination of collection equipment between sites
Inclusion of field negative controls to monitor for contamination

22. Novel eDNA applications
Moving eDNA beyond aquatic environments to terrestrial environments
eDNA from browsed vegetation
eDNA from drinking water
eDNA from snow tracks
eDNA from invertebrate “samplers”
eDNA from salt licks?
Any other ideas?
So far most eDNA research has been focused on aquatics (for vertebrates at least)

23. Used eDNA from saliva on browsed twigs to identify ungulate species (moose, roe deer, fallow deer and red deer)
Found the DNA could be amplified up to 12 weeks later
Could be used to study browsing habits of different species without direct observation
Could be used to detect rare ungulates

24. eDNA from drinking water
eDNA sampling of watering holes could be used to detect species that drank there
We were able to recover and sequence coyote eDNA from drinking water at the Coyote research facility
Could be especially useful to survey desert species
e.g. kit foxes in S. Utah

25. eDNA from Snow Tracks eDNA extracted from snow tracks of Polar bear

26. Used mammalian DNA in blood collected from leeches
2012
Used mammalian DNA in blood collected from leeches
21 of 25 leeches collected in Vietnam contained mammal DNA from 6 different species
This included the recently discovered (in 1997) and extremely rare Truong Son munjtac
This technique could have great promise for surveying mammals in areas where leaches are common such as SE Asia

27. Used DNA from carrion flies, flies which feed on dead animals and wounds on live animals and scat
Of 115 flies collected in Africa and Madagascar, 46 contained mammal DNA from 20 different species
Included small and large mammals, canopy living mammals and bats

28. Carrion flies exist world-wide, and are easy to trap
This tool could greatly improve upon surveys of mammal diversity

29. Advantages of eDNA
Does not require sighting or handling of target species
Does not require taxonomic expertise or animal handling skills
Generally has higher detection probabilities and greater sensitivity than traditional sampling techniques
Is often (but not always) more economical than traditional sampling techniques
Once an assay is established, samples are very inexpensive to run (e.g. ~$20 per sample for multiples of 48 samples)
Multiple assays (different species queries) can be run on the same samples

30. Limitations of eDNA No detection of individuals
Primer/probe designs are species-specific and require considerable up-front investment
Pilot work is necessary to understand variance in detectability for different species and systems

31. Recent Publications
The journal Biological Conservation has an upcoming special issue dedicated to eDNA:

32. Labs USU Molecular Ecology Lab assay development, pilot testing
service lab billing
linkage to graduate/ undergrad projects
Karen Mock
Pisces Molecular
private company in Boulder, CO
excellent choice for high throughput work for established assays