1. THE NU SKIN OPPORTUNITY The world’s leading anti-aging company is addressing the sources of aging, not just the signs and symptoms.

2. TRADITION OF INNOVATION 2 Nu Skin 180 Galvanic Spa Scanner Nano g3 TruFace essence ultra

3. SIGNS Developing products that address the sources of aging, not just the signs and symptoms. What is ageLOC?

4. D. James Morré, PhD Department of Medicinal Chemistry and Molecular Pharmacology and Dorothy M. Morré, PhD Department of Foods and Nutrition Purdue University, West Lafayette, Indiana ARNOX, AN AGING ENZYME: 1 ST AGELOC SOURCE OF AGING

5. Identified a NOX which increases with age Nicotinamide adenine dinucleotide OXidase, a hydroquinone oxidase

6. NOX Quinone Reductase Q 10 Q 10 H 2 1/2 O 2 H2OH2O NAD(P)H + H + NAD(P) + Protein S S Outside Inside Plasma Membrane 2 O 2 SH 2 O 2 - arNOX Generates Superoxide O 2 - A powerful free-radical generator

7. GENESIS OF AGELOC Why Some People Look Years Younger Than They Really Are. The arNOX discovery helped explain…

8. HUMAN GENOME Our genome encodes for: – our looks – our size – how our bodies work – our health – our behaviors – Our longevity

9. Genes impact structure and function of the body Health or Beauty Index YEARS

10. 2003 discovery after 20 years of research: 25,000 – 30,000 genes form the human genome Twenty Labs with hundreds of scientists (United States, the United Kingdom, France, Germany, Japan and China), $3 billion After 20 yrs Human Genome Sequenced

11. The Human Genome consistsof at least 25,000 – 30,000 genes GATCGACTCCTCCTGGVGCAGCGTGAATATCGATAGAGATCCCTTCGAGGATCGACTCCC TTCCTGGVGCAGCGTGAATATCGATAGAGATCCCTTCGAGAAAGTGATCGACTCCCTTCCT GGVGCAGCGTGAATATCGATAGAGATCCCTTCGAGAAAGTGATCGACTCCCTTCCTGGVG CAGCGTGAATATCGATAGAGATCCCTTCGAGAAAGTGATCGACTCCCTTCCTGGVGCAGC GTGAATATCGATAGAGATCCCTTCGAGAAAGTGATCGACTCCCTTCCTGGVGCAGCGTGA ATATCGATAGAGATCCCTTCGAGAAAGTGATCGACTCCCTTCCTGGVGCAGCGTGAATATC GATAGAGATCCCTTCGAGAAAGTGATCGACTCCCTTCCTGGVGCAGCGTGAATATCGATA GAGATCCCTTCGAGAAAGTGATCGACTCCCTTCCTGGVGCAGCGTGATCGACTCCCTTCC TGGVGCAGCGTGAATATCGATAGAGATCCCTTCGAGAAAGTGATCGACTCCCTTCCTGGV GCAGCGTGAATATCGATAGAGATCCCTTCGAGAAAGTGAATATCGATAGAGATCCCTTCG AGAAAGTGATCGACTCCCTTCCTGGVGCAGCGTGAATATCGATAGAGATCCCTTCGAGAA AGTGATCGACTCCCTTCCTGGVGCAGCGTGAATATCGATAGAGATCCCTTCGAGAAAGTG ATCGACTCCC---TTCCTGGVGCAGCGTGAATATCGATAGAGATCCCTTCGAGAAAGT AAAGT

12. Nu Skin Enterprises Center for Anti- Aging Research (NSE:CAAR)

13. NSE:CAAR Anti-Aging Genetic Experts Published over 300 scientific papers, and their insights have changed the way aging is viewed.

14. NSE: Center for Anti-Aging Research Experts in the study of the ultimate source of aging; our genes. 30 Years of pioneering anti-aging research. Their work both details the genetic basis of aging, and demonstrates that biological aging is no longer considered an inexorable or inevitable process.

15. Cell nucleus DNA (stored on chromosomes) Genetics 101

17. ULTIMATE SOURCE OF AGING = GENE EXPRESSION As you age, your genes don’t change Which genes are turned on and off does change (e.g. gene expression). Expression levels are influenced by your environment (stress, nutrition, etc…)

18. IDENTICAL TWINS ARE DIFFERENT How is this possible, as their genes are the same? It turns out that while the genes are identical, the level at which gene is turned on and off changes based on environmental factors (e.g. gene expression). This causes the differences you can see.

19. Yellow shows where the twins have similar gene regulation. Red and Green indicate differences (up and down regulation).

20. To better understand aging, we need to know the expression level for every gene. arNOX Elastin …in a single experiment.

21. Gene Expression Profiling 101 arNOX (0) Elastin (8) Collagen (6) MMP (2) Microarray (e.g. Gene Chip) Young Skin Key - High Activity - Off - Medium Activity - Low Activity Gene 1 arNOX Gene 2 Elastin Gene 3 Collagen Gene 4 MMP Young Skin Fibroblast (Hypothetical) DNA mRNA

23. The expression level for every gene in a single experiment! arNOX Elastin Key - High Activity - Off - Medium Activity - Low Activity DNA Microarray Gene Map Over 25000 Genes

24. NuSkin ageLOC Approach Identify Youth Gene Clusters (YGC’s), and understand their youthful expression patterns Target - Investigate the effect different ingredients have on YGC’s. Reset - Develop formulae that reset these YGC’s back to their youthful state, thus restoring the youthful biochemistry of a cell.

25. What is a Youth Gene Cluster (YCG) These are groups of genes (e.g. clusters) that work together to exert a specific function in a tissue associated with youthfulness. Tissue specific Act as master regulators of aging.

27. Younger Than Chronological Age

28. In additional to understanding the genetic basis of aging in Humans, mice, fruit flies, yeast and roundworms are also fruitful models for the genetic/aging scientist

29. Gene Expression Profiling 101 Gene 1 arNOX Gene 2 Elastin Gene 3 Collagen Gene 4 MMP Young Skin Fibroblast (Hypothetical) DNA mRNA Gene 1 arNOX Gene 2 Elastin Gene 3 Collagen Gene 4 MMP Old Skin Fibroblast (Hypothetical) DNA mRNA

30. Gene Expression Profiling 101 Young SkinOld Skin arNOX (0) Elastin (8) Collagen (6) MMP (2) arNOX (8) Elastin (0) Collagen (2) MMP (4) Key - High Activity - Off - Medium Activity - Low Activity Down regulationUp regulationNo Change arNOX (+8) Elastin (-8) Collagen (-4) MMP(+2) Changes with Aging By comparing the two, you can understand the genetic changes associated with aging

32. INTELLIGENT BIOINFORMATICS DATABASE YOUTH GENE CLUSTERS

33. Map of Aging Genetics (Whole Genome) Huge Proprietary Database Over 25 Million aging related genetic changes and growing. Bio-Informatics on this database yields the genetic map of the aging process Shows us the path we need to take

34. ageLOC Process Identifying Youth Gene Clusters (YGC’s), and understanding their youthful expression level Targeting - Cataloging the effect different ingredients have on YGC’s. Resetting - Developing formulas that reset these YGC’s back to their youthful state, thus restoring the youthful biochemistry of a cell.

35. How Do We Target and Reset YGC’s - Remember the Gene Chip? Key - High Activity - Off - Medium Activity - Low Activity DNA Microarray Gene Map Over 20000 Genes

36. Identifying Changes (Old vs. Young YGC Profile) Young Skin Old Skin A B C D A B C D Key - High Activity - Off - Medium Activity - Low Activity By comparing the two, you can understand the genetic changes associated with aging

38. Targeting & Resetting YGC Young Skin Old Skin A B C D A B C D Key - High Activity - Off - Medium Activity - Low Activity Once you map the changes, you can screen for ingredients and formulas that reverse these changes Post Application A B C D AGING ageLOC

39. ageLOC Process Identifying Youth Gene Clusters (YGC’s), and understanding their youthful expression level Targeting - Cataloging the effect different ingredients have on YGC’s. Resetting - Developing formulas that reset these YGC’s back to their youthful state, thus restoring the youthful biochemistry of a cell.

40. SECOND GENERATION AGELOC PRODUCTS

41. Gene Activity in Skin Cells DNA Microarray Gene Map Over 25000 Genes

42. Skin Structure TIMP1 COL7A1 AQP3 IL1B PPARG TNFA POMC IL1B IL6 SOD2 MT2A TXNRD1 60+ GENES For Human Skin: 4 YGCs identified Pigment 20+ GENES Cell Turnover 35+ GENES Hydration 20+ GENES

43. Texture, Smoothness Radiance Pore Size Hydration Discoloration Skin Tone Signs of Aging Fine Lines & Wrinkles Youthful Skin Structure Four YGCs Identified Youth Gene Clusters PigmentHydration Cellular Turnover ageLOC Science Skin Structure

44. Changes in gene activity patterns yield tissue changes as we age “Interventions can impact gene activity patterns even late in life and may reverse skin aging”* *Adler, Chang et al. Cell Cycle 2008;7(5):556-559

45. “THE PROOF IS IN THE PUDDING” Meaning: The true value or quality of something can only be judged when it's put to use. “Nu Skin has never developed a product that delivers these kind of results before (both in clinical results and user perception” Dr. Helen Knaggs, PhD VP of NuSkin R&D

46. 1.Nu Skin Enterprises Center for Anti-Aging Research (NSE:CAAR) brings together experts in the field of anti-aging genetics 2.Only we can Identify Youth Gene Clusters (YGC) 3.AgeLOC Science Targets the Ultimate Sources of Aging 4.Only Nu Skin understand how to Reset Youth Gene Clusters to their youthful state 5.Over the next 10 years as the ageLOC approach matures, its full impact will be realized on many more products - enabling Nu Skin to stay years ahead of our competition ageLOC Summary

48. Nutritional Intervention affects age related gene expression and can Reverse Aging Lee et al, Science 1999;285(5432):1390-3; Colman et al, Science 2009;325:201-204

49. AGELOC OBJECTIVE: LIFESPAN VS. HEALTH or BEAUTY SPAN Health or Beauty Index YEARS

50. THANK YOU