Presentation is loading. Please wait.

Presentation is loading. Please wait.

Use of SNP-DNA analysis in authenticating Basmati rice.

Published bySkyla Creighton Modified over 10 years ago

Similar presentations

Presentation on theme: "Use of SNP-DNA analysis in authenticating Basmati rice."— Presentation transcript:

1 Use of SNP-DNA analysis in authenticating Basmati rice

2 DNA based authentication of basmati rice Background to Single nucleotide polymorphisms (SNPs) Introduction to SNP genotyping using MALDI-ToF MS Authentication of basmati rice using MALDI-ToF MS-based SNP genotyping Launching a commercial genotyping service Summary

3 Authentication of basmati rice by DNA genotyping Micro-satellite markers Single nucleotide polymorphisms

4 TCGAAATGCATGCGCATGATT Variety 1 TCGAAATGCATGCGCGTGATT Variety 2 Single nucleotide differences exist between individuals, plant and animal varieties and bacterial strains Single nucleotide polymorphisms

5 Authentication using SNPs PCR based SNP genotyping MALDI-ToF MS based SNP genotyping Single nucleotide polymorphisms

6 Once a SNP is identified, 3 primers are required to enable genotyping including:- - Two PCR primers to amplify the region around the SNP 5’ 3’ - One Extension primer which anneals directly adjacent to the SNP. 5’ 3’ Assaying SNPs by MALDI-ToF MS

7 TCGAAATGCATGCGCATGATT TCGAAATGCATGCGCGTGATT TCGAAATGCATGCGCATGATT TCGAAATGCATGCGCGTGATT TTACGTACGCG TCGAAATGCATGCGCATGATT TCGAAATGCATGCGCGTGATT TTACGTACGCGT TTACGTACGCGC +polymerase +ddNTP’s Anneal primer Analyse extension products by MALDI-TOF MS Assaying SNPs by MALDI-ToF MS

8 MALDI-TOF Mass Spectrometry Samples mixed with a matrix in great excess and spotted onto a MALDI plate and loaded into the Mass Spectrometer. Sample spot is subjected to repeated pulses of a nitrogen laser at 337nm in a vacuum which vaporises and ionises sample. Matrix absorbs the majority of incident laser energy, preventing degradation or fragmentation of the sample, and allows the vaporisation and ionisation of some of the substrate. Delayed application of an electric field causes ions to enter flight tube and accelerate towards detector. Delayed Extraction applies high voltage electric pulse after predetermined time delay to minimise energy spread of ions. All ions gain same kinetic energy, so larger ions take longer to reach detector. This variation in Time of Flight allows the separation of ions on the basis of size.

9 Assaying SNPs by MALDI-ToF MS C = 273 Da T = 288 Da A = 297 Da G = 313 Da Difference in peak size reveals the SNP allele for that rice variety Unextended SNP primer Extended SNP primer

10 Multiplexing SNP assays

11 Quantitative SNP assays

12 MALDI-TOF-based DNA authentication of basmati rice Sponsored by the FSA

13 Completing a SNP database for the main commercial varieties and their adulterants. Assessing the reproducibility of the protocols to determine the uncertainty of the method. Performing a limited survey of Basmati Products being sold in UK supermarkets. Developing a Standard Operating Procedure FSA sponsored work includes:-

14 Basmati rice varieties Traditional breeds Basmati 386 Basmati 370 Dehradun Ranbir Basmati Taraori (HBC-19) Hybrid Basmati 385 Super Basmati Pusa Basmati Kasturi Basmati 198 Common Adulterants Pusa 169 Sabarmati PR 106 Kali-much Lakra Saket 4 Parimal Sherbati Terricot

15 Assembling a SNP database for Basmati varieties and adulterants

16 Assessing reproducibility

17 Examples of survey work

18 SNP Genotyping using primer I PrimerPrimer + TPrimer + C Tilda basmati Rice ASDA basmati rice

19 SNP Genotyping using 11 primers Tilda basmati rice behaves like traditional variety Kernal Asda basmati rice is most like the basmati hybrid Pusa

20 MALDI-ToF MS based genotyping represents an effective analytical approach to assess:- Product authentication using a diagnostic panel of multiplexed SNP markers based on an expanded database. Product adulteration, exploiting the techniques ability to quantitate SNPs in the 5-100% range. Summary

21 SNP analysis as a QC tool

22 SNP markers revealed that results with the 2003 crop could NOT have arisen from mixing Super Basmati (S) with Thai (T) rice

23 Applying cutting-edge DNA technology to provide analytical services for product authentication to the food industry. http://Authentigene.com http://Authentigene.info THE gold standard Providing a commercial genotyping service

24 The Authentigene team Prof. David Archer Prof. Malcolm Bennett Prof. Ian Connerton Dr. Sean May Prof. Gregory Tucker

Download ppt "Use of SNP-DNA analysis in authenticating Basmati rice."

Similar presentations

Lecture 2 Strachan and Read Chapter 13

Lecture 2 Strachan and Read Chapter 13
Applications of genome sequencing projects 1) Molecular Medicine 2) Energy sources and environmental applications 3) Risk assessment 4) Bioarchaeology,

Applications of genome sequencing projects 1) Molecular Medicine 2) Energy sources and environmental applications 3) Risk assessment 4) Bioarchaeology,
applications of genome sequencing projects

applications of genome sequencing projects
An Introduction to the application of Molecular Markers

An Introduction to the application of Molecular Markers
Fingerprinting and Markers for Floral Crop Improvement James W. Moyer Dept. of Plant Pathology North Carolina State University, Raleigh, NC 27695.

Fingerprinting and Markers for Floral Crop Improvement James W. Moyer Dept. of Plant Pathology North Carolina State University, Raleigh, NC
Introduction to MALDI-TOF MS

Introduction to MALDI-TOF MS
MALDI-TOF Mass Spectrometry and Introduction to Proteomics Dr. Steve Hartson Oklahoma State University Dept. Biochemistry and Molecular Biology Recombinant.

MALDI-TOF Mass Spectrometry and Introduction to Proteomics Dr. Steve Hartson Oklahoma State University Dept. Biochemistry and Molecular Biology Recombinant.
Lecture 9. MALDI/TOF. Introduction Matrix-assisted laser desorption/ionization (MALDI) is a soft ionization technique used in mass spectrometry, allowing.

Lecture 9. MALDI/TOF. Introduction Matrix-assisted laser desorption/ionization (MALDI) is a soft ionization technique used in mass spectrometry, allowing.
DNA polymorphisms Insertion-deletion length polymorphism – INDEL Single nucleotide polymorphism – SNP Simple sequence repeat length polymorphism – mini-

DNA polymorphisms Insertion-deletion length polymorphism – INDEL Single nucleotide polymorphism – SNP Simple sequence repeat length polymorphism – mini-
Mass Spectrometry Separation principle: A particle with a certain mass (m) and a certain charge (z) behaves in a predictable manner when exposed to a electromagnetic.

Mass Spectrometry Separation principle: A particle with a certain mass (m) and a certain charge (z) behaves in a predictable manner when exposed to a electromagnetic.
Mass Spectrometry in the Biosciences: Introduction to Mass Spectrometry and Its Uses in a Company Like Decode. Sigurður V. Smárason, Ph.D. New Technologies.

Mass Spectrometry in the Biosciences: Introduction to Mass Spectrometry and Its Uses in a Company Like Decode. Sigurður V. Smárason, Ph.D. New Technologies.
PROTEIN IDENTIFICATION BY MASS SPECTROMETRY. OBJECTIVES To become familiar with matrix assisted laser desorption ionization-time of flight mass spectrometry.

PROTEIN IDENTIFICATION BY MASS SPECTROMETRY. OBJECTIVES To become familiar with matrix assisted laser desorption ionization-time of flight mass spectrometry.
SNPs Human Genome. SNP Typing Allele specific hybridization ASO probes usually with the polymorphic base in a central position in the probe sequence.

SNPs Human Genome. SNP Typing Allele specific hybridization ASO probes usually with the polymorphic base in a central position in the probe sequence.
Introduction to DNA.

Introduction to DNA.
Genomic DNA purification

Genomic DNA purification
Y.Martinez.

Y.Martinez.
Techniques used to analyze DNA. DNA Replication DNA replicates itself prior to cell division. DNA replication begins with the unwinding of the DNA strands.

Techniques used to analyze DNA. DNA Replication DNA replicates itself prior to cell division. DNA replication begins with the unwinding of the DNA strands.
Variants of PCR Lecture 4

Variants of PCR Lecture 4
Analysis of Norwegian BRCA mutations using Sequenom MALDI TOF MS Ann Curtis on behalf of James Eden Institute of Human Genetics Newcastle University.

Analysis of Norwegian BRCA mutations using Sequenom MALDI TOF MS Ann Curtis on behalf of James Eden Institute of Human Genetics Newcastle University.
Identical twins are two individuals that are genetically identical. What does this mean? How can a sheep that is 12 years old have an identical twin who.

Identical twins are two individuals that are genetically identical. What does this mean? How can a sheep that is 12 years old have an identical twin who.

Similar presentations

Ads by Google