1. o Record Definitions in your notebook: Somatic Cells  Any cell in a multicellular organism except a sperm or egg cell (gametic cells) Gametic cells  A haploid cell such as an egg or sperm Sex-linked trait are inherited genes that do determine an individual’s sex Autosomal trait are inherited via genes that do not determine an individual’s sex Exon  a coding region of a eukaryotic gene Intron  a noncoding, intervening sequence within a eukaryotic gene

3. DO NOW: Record definitions/diagrams in notebooks Phenotype: the physical and physiological traits of an organism Karyotype: a method of organizing the chromosomes of a cell in relation to number, size, and type

4. Mutations and Their Significance

5. Sickle Cell Anemia Normal hemoglobin gene …ACTCCTGAGGAG… Mutated hemoglobin gene …ACTCCTGTGGAG… Mutation type _____________________ Result: Harmful, DNA base is changed, this change substitutes the amino acid valine for glutamic acid. Sickle cell disease is harmful, sometimes fatal. substitution

6. Huntington’s Disease Normal HAP-1 gene …TACCCGTTACAGGCA… Mutated HAP-1 gene …TACCCGTTACAGCAGCAGCAGCAGCAGGCA… Mutation type _____________________ Result: Harmful, genetic defect on chromosome 4. The defect causes a part of DNA, called a CAG repeat, to occur many more times than it is supposed to. duplication/repeat

7. Resistance to HIV Normal CKR-5 gene (susceptible to HIV infection) …CATTTTCCATACAGTCAGTATCAATTCTGGAAGAAT TTCCAGACATTAAAG… Mutated CKR-5 gene (highly resistant to HIV) …CATTTTCCATACATTAAAG… Mutation type _____________________ Result: Beneficial, protects individuals against strains of HIV deletion

8. Cystic Fibrosis Normal CFTR gene …AGCTAACAGGGG… Mutated CFTR gene …AGCTAGGGG… Mutation type _____________________ Result: Harmful, thick mucus that clogs their lungs and breathing passageways deletion

9. RNA and Protein Synthesis

10. The Structure of RNA List the three main differences between RNA and DNA. o 1. DNA is double stranded, RNA is single stranded o 2. mRNA is a compliment to the DNA, but it uses uracil (U) instead of thymine (T) o 3. The sugar is RNA is ribose instead of deoxyribose

11. The Structure of RNA Is the following sentence true or false? RNA carries the genetic message from DNA in the nucleus to the ribosomes in the cytoplasm. True

12. Types of RNA TypeFunction _____________Carries copies of the instructions for assembling amino acids from DNA to the rest of the cell _____________Together with proteins forms the structures of ribosomes _____________Organelle that functions as the site of protein synthesis in the cytoplasm _____________Transfers each amino acid to the ribosome to help assemble proteins

14. Transcription Which of the following sentences are true about transcription? 1. RNA Polymerase binds to DNA and separates the DNA strands 2. RNA polymerase uses one strand of DNA as a template to assemble nucleotides into a strand of RNA 3. Sequences of DNA that are not involved in coding for proteins are introns 4. The DNA sequences that code for proteins are called exons

15. Transcription The purpose of transcription is to make a copy of the genetic code contained in the DNA sequence into mRNA which can leave the nucleus Enzymes copy one strand of DNA into a single- stranded mRNA molecule ( A binds with U, T binds with A, G binds with C)

16. RNA Splicing Many RNA molecules from eukaryotic genes have sections, called __________, edited out of them before they become functional. The remaining pieces, called __________, are splice together.

17. Genes code for polypeptides DNA triplets (codons) code for one amino acid Amino acids link together to form polypeptides. Polypeptide presence or absence determines an organism’s traits The Genetic Code

18. Proteins are made by joining ___________ into long chains called _______. RNA contains ____ different bases: _______, ________, _________, ________. The genetic code is read three letters at a time. Each three letter “word” in mRNA is known as a codon. A _______ consists of three consecutive nucleotides that specify a single amino acid

19. Translation mRNA is transcribed in the nucleus, then enters the cytoplasm and attaches to a ribosome Translation begins at AUG, the start codon. Each tRNA has an anticodon whose bases are complimentary to a codon on the mRNA strand The ribosome positions the start codon to attract an anticodon, which is the part of tRNA that binds the codon The ribosome moves along mRNA, binding new tRNA molecules and amino acids

20. COMPONENTS THAT MAKE UP THE GENETIC CODE ARE COMMON TO ALL ORGANISMS Including, but not limited to: o Universality of code (with some exceptions) o Structure of DNA is similar for most organisms o DNA triplets code for the same amino acids in most organisms

21. Changes in DNA Change in Base Sequence Vs. Chomosome-level changes InsertionDuplicationDeletion Substitution Inversion FrameshiftTranslocation PointNon-disjunction

22. Changes in Base Sequence Frameshift o Changes all codons from that point foward

23. Changes in Base Sequence Point Mutation o No change in amino acid (silent) o Change in a single amino acid Sickle cell anemia PKU (Phenylketonuria) Hemophilia Color blindness Huntington’s disease Tay-Sachs disease Cystic fibrosis

24. Changes in Base Sequence Chromosome-level changes o Normal karyotype to abnormal karyotype. o Results of non-disjunction Down syndrome Turner syndrome Klinefelter syndrome Cri-du-chat syndrome Some mutations are beneficial to the organism. o CKR5 deficiency (resistance to HIV) Process of evolution occurs because of changes in traits caused by mutations