Presentation is loading. Please wait.

Presentation is loading. Please wait.

Synthesizing results across multiple GWA studies and integrating them into the existing knowledge base Marta Gwinn, MD, MPH National Office of Public Health.

Published byStella Askin Modified over 10 years ago

Similar presentations

Presentation on theme: "Synthesizing results across multiple GWA studies and integrating them into the existing knowledge base Marta Gwinn, MD, MPH National Office of Public Health."— Presentation transcript:

1 Synthesizing results across multiple GWA studies and integrating them into the existing knowledge base Marta Gwinn, MD, MPH National Office of Public Health Genomics CDC Adding Genome-Wide Association to Population Studies Boston, June 22, 2007 GTCGACTGGAGTGTCTGTGAATTGACTTTTGTTGCCAGTTGGCAGCGGCAGAAGCAGCAAAGCCCGGCCAACAGCAACAAGCTCCTGCCAGATCCCAAAAGCAAACACG

2

3 Data Information Knowledge?

4 Synthesizing and integrating results of GWA Review replication of genetic associations –Identifying associations vs. measuring effects –Methodological issues Describe network approaches –Human Genome Epidemiology Network (HuGENet) –Other examples Discuss two important results GTCGACTGGAGTGTCTGTGAATTGACTTTTGTTGCCAGTTGGCAGCGGCAGAAGCAGCAAAGCCCGGCCAACAGCAACAAGCTCCTGCCAGATCCCAAAAGCAAACACG

5 * HuGE Published Literature 323966 80 109184 gene-disease association gene-environment interaction meta-analysis 32 Genetic association studies of unrelated persons Extracted from PubMed, 2001-2006*

6 “We suggest that this rapid, early succession of extreme findings may be called the Proteus phenomenon after the mythologic god who rapidly metamorphosed himself to very different figures.”

7 Published literature scan Systematic reviews Strengthened reporting Network collaboration http://www.hugenet.org.uk http://www.dhe.med.uoi.gr/hugenet.htm http://www.hugenet.ca HuGENet Canada Human Genome Epidemiology (HuGE) www.cdc.gov/genomics/hugenet GTCGACTGGAGTGTCTGTGAATTGACTTTTGTTGCCAGTTGGCAGCGGCAGAAGCAGCAAAGCCCGGCCAACAGCAACAAGCTCCTGCCAGATCCCAAAAGCAAACACG

8 HuGENet Network of Networks Single teams Single studies Published and unpublished data Systematic reviews Meta-analyses Field-wide synopses Feedback Reporting Synthesis Grading Commentary, Nature Genetics 38, 3 - 5 (2006) A road map for efficient and reliable human genome epidemiology STREGA 6/2006 Handbook 3/2006 Venice 11/2006 Atlanta 1/2008 11/2005

9 Replication of genetic associations Heterogeneity –unmeasured factors Statistical uncertainty –sampling variability –low power Bias –all the usual epidemiologic biases –publication bias GTCGACTGGAGTGTCTGTGAATTGACTTTTGTTGCCAGTTGGCAGCGGCAGAAGCAGCAAAGCCCGGCCAACAGCAACAAGCTCCTGCCAGATCCCAAAAGCAAACACG -- including exposures -- to detect small effects -- among many comparisons

10 Replication of genome-wide associations Heterogeneity –unmeasured factors Statistical uncertainty –sampling variability –low power Bias –all the usual epidemiologic biases –publication bias GTCGACTGGAGTGTCTGTGAATTGACTTTTGTTGCCAGTTGGCAGCGGCAGAAGCAGCAAAGCCCGGCCAACAGCAACAAGCTCCTGCCAGATCCCAAAAGCAAACACG -- genetic background -- meta-analysis, prior information -- statistical methods -- transparency -- enhanced access to data

11 HuGE Systematic Reviews and Meta-analysis GTCGACTGGAGTGTCTGTGAATTGACTTTTGTTGCCAGTTGGCAGCGGCAGAAGCAGCAAAGCCCGGCCAACAGCAACAAGCTCCTGCCAGATCCCAAAAGCAAACACG Handbook for systematic reviews / meta-analyses http://www.cdc.gov/genomics/hugenet/publications/index.htm#guidelines Online database of systematic reviews / meta-analyses – >50 reviews published in collaboration with 10 journals – citation database of ~550 meta-analyses Proposed guidance for reporting association data Proposed criteria for evaluating evidence for association http://www.cdc.gov/genomics/hugenet

12 Synthesizing results of GWA studies: different from candidate gene studies? Study priorities may differ –GWA: find novel associations –candidate gene: measure effect size Most differences are a matter of degree –Type 1 errors, type 2 errors –harmonization among studies: phenotyping, genotyping methods –population stratification All the usual epidemiologic biases prevail GTCGACTGGAGTGTCTGTGAATTGACTTTTGTTGCCAGTTGGCAGCGGCAGAAGCAGCAAAGCCCGGCCAACAGCAACAAGCTCCTGCCAGATCCCAAAAGCAAACACG

13 Meta-analysis of GWAs? Improve power to measure small effects Assess heterogeneity among GWAs Methodological challenges –use of different genotyping platforms / different SNPs –harmonization of phenotypic data –treatment of replication samples within same GWA Good for horizontal integration—only one dimension of evidence GTCGACTGGAGTGTCTGTGAATTGACTTTTGTTGCCAGTTGGCAGCGGCAGAAGCAGCAAAGCCCGGCCAACAGCAACAAGCTCCTGCCAGATCCCAAAAGCAAACACG

14 Ioannidis JP. Commentary: grading the credibility of molecular evidence for complex diseases. Int J Epidemiol 2006

15 Bridge “cottage industry” with “Big Science” Domain experts may share: – specific knowledge (e.g., phenotype definitions) – awareness of current research problems – funding sources Many networks already exist – NCI Cancer Genetic Markers of Susceptibility (CGEMS ) – NINDS Human Genetics Repository – International Collaborative Study on Genetic Susceptibility to Environmental Carcinogens (GSEC) – Preterm Birth International Collaborative (PREBIC) Why a “Network of Networks?” GTCGACTGGAGTGTCTGTGAATTGACTTTTGTTGCCAGTTGGCAGCGGCAGAAGCAGCAAAGCCCGGCCAACAGCAACAAGCTCCTGCCAGATCCCAAAAGCAAACACG Hoover RN. The evolution of epidemiologic research: from cottage industry to "big" science. Epidemiology Jan 2007;18:13-7.

16 Copyright ©2007 by the National Academy of Sciences Goh, Kwang-Il et al. (2007) Proc. Natl. Acad. Sci. USA 104, 8685-8690 Fig. 2. The HDN and the DGN

17 The AlzGene database on www.alzforum.orgwww.alzforum.org

18

19

20 CARD15 (NOD2) and Crohn’s disease - 2001 positional cloning, candidate gene studies - risk genotype prevalence 0.3, 0.1 - relative risk 3, 40 - disease risk 0.001 CFH and age-related macular degeneration - 2005 genome-wide association study - risk genotype prevalence 0.2, 0.05 - relative risk 5, 7 - disease risk 0.05 (by age 60) GTCGACTGGAGTGTCTGTGAATTGACTTTTGTTGCCAGTTGGCAGCGGCAGAAGCAGCAAAGCCCGGCCAACAGCAACAAGCTCCTGCCAGATCCCAAAAGCAAACACG A Tale of Two Associations * Note: all estimates are approximate!

21 Genetic Associations with Crohn Disease HuGE Published Literature, June 2007 **as of June 2007 ** * *indicates number of meta-analyses, including 3 meta-analyses of CARD15 1 1 1 4

22 Early success –“Ideal” combination of genotype prevalence, effect size and population disease risk? –Key insights into pathogenesis, phenotype Unmet expectations, translation frustrations –No replication in some populations (Japanese) –Disappointing clinical trials (infliximab) Help from GWA GTCGACTGGAGTGTCTGTGAATTGACTTTTGTTGCCAGTTGGCAGCGGCAGAAGCAGCAAAGCCCGGCCAACAGCAACAAGCTCCTGCCAGATCCCAAAAGCAAACACG CARD15 (NOD2) and Crohn’s disease

23 Crohn’s disease: help from GWA Cardon L. Delivering new disease genes. Science Dec 2006;314:1403-05. Perspective on: Duerr RH, et al. A genome-wide association study identifies IL23R as an inflammatory bowel disease gene. Science Dec 2006:314;1461-63.

24 Genetic Associations with Macular Degeneration HuGE Published Literature, June 2007 **as of June 2007 ** * *includes 2 meta-analyses in each group

25 Early success of GWA Insight into pathogenesis and progression –CFH already related to kidney disease, new focus in cardiovascular disease –Interaction with smoking and BMI Translation? –No interaction with anti-oxidant vitamins/zinc supplementation (AREDS rx) –No utility for screening GTCGACTGGAGTGTCTGTGAATTGACTTTTGTTGCCAGTTGGCAGCGGCAGAAGCAGCAAAGCCCGGCCAACAGCAACAAGCTCCTGCCAGATCCCAAAAGCAAACACG CFH and Age-related macular degeneration

26 Why? –increase probability that positive associations are true –increase power to examine small associations, less common variants –zero in on causal variants –start translating data into knowledge How? –careful documentation, complete reporting, collaboration –cumulative review of evidence –integration with other epidemiologic data, as well as knowledge from other fields Synthesizing and integrating results of GWA GTCGACTGGAGTGTCTGTGAATTGACTTTTGTTGCCAGTTGGCAGCGGCAGAAGCAGCAAAGCCCGGCCAACAGCAACAAGCTCCTGCCAGATCCCAAAAGCAAACACG

27 Hokusai, Mt. Fuji Off Kanagawa, 1826-1833 Not a tsunami… Not a tsunami-- Hiroshige, A View of Eitai Bridge and Tsukuda Island, 1857 …but a rising tide that lifts all boats.

Download ppt "Synthesizing results across multiple GWA studies and integrating them into the existing knowledge base Marta Gwinn, MD, MPH National Office of Public Health."

Similar presentations

HuGENet Network of Networks Workshop: GEO-PD Consortium Demetrius M. Maraganore, MD Professor of Neurology Mayo Clinic College of Medicine Rochester, MN.

HuGENet Network of Networks Workshop: GEO-PD Consortium Demetrius M. Maraganore, MD Professor of Neurology Mayo Clinic College of Medicine Rochester, MN.
Vision for Accelerating the Development and Dissemination of the Knowledge Base on Human Genetic Variation and Health Muin J. Khoury.

Vision for Accelerating the Development and Dissemination of the Knowledge Base on Human Genetic Variation and Health Muin J. Khoury.
Genetic research designs in the real world Vishwajit L Nimgaonkar MD, PhD University of Pittsburgh

Genetic research designs in the real world Vishwajit L Nimgaonkar MD, PhD University of Pittsburgh
Establishing Research Priorities for Public Health Emergency Preparedness in Canada: Results of a Scoping Review and Priority- Setting Meeting Yasmin Khan,

Establishing Research Priorities for Public Health Emergency Preparedness in Canada: Results of a Scoping Review and Priority- Setting Meeting Yasmin Khan,
Meta-analysis for GWAS BST775 Fall 2013. DEMO Replication Criteria for a successful GWAS P

Meta-analysis for GWAS BST775 Fall DEMO Replication Criteria for a successful GWAS P
Summary points with interesting prospects IRB – handling samples in different areas/countries Opportunities for young researchers Who reviews grants and.

Summary points with interesting prospects IRB – handling samples in different areas/countries Opportunities for young researchers Who reviews grants and.
Genetic Analysis in Human Disease

Genetic Analysis in Human Disease
Perspectives from Human Studies and Low Density Chip Jeffrey R. O’Connell University of Maryland School of Medicine October 28, 2008.

Perspectives from Human Studies and Low Density Chip Jeffrey R. O’Connell University of Maryland School of Medicine October 28, 2008.
Sensitivity Analysis for Observational Comparative Effectiveness Research Prepared for: Agency for Healthcare Research and Quality (AHRQ) www.ahrq.gov.

Sensitivity Analysis for Observational Comparative Effectiveness Research Prepared for: Agency for Healthcare Research and Quality (AHRQ)
Virginia Rodriguez Funes, MD, FACS El Salvador. Background  The Latin American population it is now the largest single ethnic group in the United States,

Virginia Rodriguez Funes, MD, FACS El Salvador. Background  The Latin American population it is now the largest single ethnic group in the United States,
Estimation and Reporting of Heterogeneity of Treatment Effects in Observational Comparative Effectiveness Research Prepared for: Agency for Healthcare.

Estimation and Reporting of Heterogeneity of Treatment Effects in Observational Comparative Effectiveness Research Prepared for: Agency for Healthcare.
TM The Human Genome Epidemiology Network (HuGE Net) Muin J. Khoury, MD, Ph.D. Director, CDC Office of Genomics and Disease Prevention.

TM The Human Genome Epidemiology Network (HuGE Net) Muin J. Khoury, MD, Ph.D. Director, CDC Office of Genomics and Disease Prevention.
Robert M. La Follette School of Public Affairs GWAS Panel Jason Fletcher Associate Professor Public Affairs, Sociology, and Applied Economics University.

Robert M. La Follette School of Public Affairs GWAS Panel Jason Fletcher Associate Professor Public Affairs, Sociology, and Applied Economics University.
Genome-Wide Association for the Rest of Us: Introduction and Goals National Human Genome Research Institute National Institutes of Health U.S. Department.

Genome-Wide Association for the Rest of Us: Introduction and Goals National Human Genome Research Institute National Institutes of Health U.S. Department.
MSc GBE Course: Genes: from sequence to function Genome-wide Association Studies Sven Bergmann Department of Medical Genetics University of Lausanne Rue.

MSc GBE Course: Genes: from sequence to function Genome-wide Association Studies Sven Bergmann Department of Medical Genetics University of Lausanne Rue.
Positional Cloning LOD Sib pairs Chromosome Region Association Study Genetics Genomics Physical Mapping/ Sequencing Candidate Gene Selection/ Polymorphism.

Positional Cloning LOD Sib pairs Chromosome Region Association Study Genetics Genomics Physical Mapping/ Sequencing Candidate Gene Selection/ Polymorphism.
SOME ADDITIONAL POINTS ON MEASUREMENT ERROR IN EPIDEMIOLOGY Sholom May 28, 2011 Supplement to Prof. Carroll’s talk II.

SOME ADDITIONAL POINTS ON MEASUREMENT ERROR IN EPIDEMIOLOGY Sholom May 28, 2011 Supplement to Prof. Carroll’s talk II.
Introduction of Cancer Molecular Epidemiology Zuo-Feng Zhang, MD, PhD University of California Los Angeles.

Introduction of Cancer Molecular Epidemiology Zuo-Feng Zhang, MD, PhD University of California Los Angeles.
Give me your DNA and I tell you where you come from - and maybe more! Lausanne, Genopode 21 April 2010 Sven Bergmann University of Lausanne & Swiss Institute.

Give me your DNA and I tell you where you come from - and maybe more! Lausanne, Genopode 21 April 2010 Sven Bergmann University of Lausanne & Swiss Institute.
Study Design Discussion The Ghost of Candidate Gene Past and the Ghost of Genome-wide Association Yet to Come Stephen S. Rich, Ph.D. Wake Forest University.

Study Design Discussion The Ghost of Candidate Gene Past and the Ghost of Genome-wide Association Yet to Come Stephen S. Rich, Ph.D. Wake Forest University.

Similar presentations

Ads by Google