Download presentation
Published byDarius Crooms Modified over 10 years ago
1
Minimal Residual Disease analysis in childhood ALL
Dr Jerry Hancock Scientific Co-ordinator of UKMRD Laboratory Network Bristol Genetics Lab
2
Survival in Childhood ALL
3
Prognostic factors used to direct therapy
Fixed factors Age, sex, white cell count at diagnosis, cytogenetics Dynamic factors response to treatment correlates with prognosis slow early response (SER) assessed by microscopy predicts relapse predicts outcome within groups of children with the same fixed risk factors receiving the same therapy BUT the microscope is an insensitive tool for detection of residual leukaemia and most destined to relapse have a rapid response
4
Analysis of outcome for MRC UKALL 97/99 Trial - Stratification of Treatment based on “clinical risk”
Characteristics N Arm A <10 yrs AND WCC <50 AND RER 62 Arm B >10 yrs or WCC >50 22 Arm C A or B AND SER Or poor cytos 16 Intensity of Therapy
5
Analysis of outcome for MRC UKALL 97/99 Trial - Stratification of Treatment based on “clinical risk”
Characteristics N EFS (%) Arm A <10 yrs AND WCC <50 AND RER 62 84 Arm B >10 yrs or WCC >50 22 70 Arm C A or B AND SER Or poor cytos 16 Intensity of Therapy
6
Analysis of outcome for MRC UKALL 97/99 Trial - Stratification of Treatment based on “clinical risk”
Characteristics N EFS (%) Relapse Arm A <10 yrs AND WCC <50 AND RER 62 84 11 (52%) Arm B >10 yrs or WCC >50 22 70 6 (28%) Arm C A or B AND SER Or poor cytos 16 4 (20%) Intensity of Therapy Only 20% of relapse comes from highest risk group Many of those cured are over-treated
7
Relative frequency of leukaemic cells
Haematologic remission 1012 1011 107 MRD “cure” Relapse MRD Analysis Follow-up In years Detection limit of PCR technique cytomorphology Relative frequency of leukaemic cells Minimal Residual Disease
8
Prognostic value of MRD
MRD shown to have independent prognostic value in ALL Childhood ALL van Dongen et al 1998 Cavé et al 1998 Coustan-Smith et al 1998 Relapsed childhood ALL Knechtli et al 1998 Eckert et al 2001 Goulden et al 2003 Adult ALL Bruggeman et al 2006 Raff et al 2007
9
van Dongen et al, Lancet 1998 = 98% = 78% = 20%
10
Quantitative MRD Detection
Three methods currently available : Flow cytometric immunophenotyping Utilises tumour associated aberrant immunophenotypes E.g. Presence of myeloid markers on leukaemia blasts Reverse transcriptase (RT) PCR Utilises tumour specific RNA targets E.g. Fusion gene transcripts Real-time Quantitative (RQ) PCR Utilises patient-specific gene rearrangements E.g. Immunoglobulin and T-cell receptor gene rearrangements Utility of method chosen depends upon the aim of the study Important considerations: applicability, stability, sensitivity & quantitation RQ-PCR methodology is method of choice in most European MRD-based clinical trials
11
RQ-PCR for MRD analysis
Methodology identifies unique Immunoglobulin and/or T-cell receptor gene rearrangements that are clone-specific 98% of patients will have at least one clonal rearrangement Two patient-specific RQ-PCR assays are designed for each patient capable of detecting one leukaemic cell in a background of 10,000 marrow cells Important to prevent false-negative results due to clonal evolution 80-85% of patients will have two assays quantitative to 1 in 10,000
12
Scheme of Investigation
- identification of patient-specific MRD marker PCR analysis of diagnostic DNA Heteroduplex analysis of PCR products Purify and sequence clonal rearrangement TTGTAGTAGTTACCAGCTGGGCTATGAATACTTCCAGCACTGGG D region J region N region Identification of V, D and J segment usage Synthesis of base patient-specific oligonucleotide In Patient-specific RQ-PCR for MRD Analysis 8 4
13
ALL2003 Randomisation Algorithm
14
UKMRD Laboratory Network Glasgow Sheffield Bristol Barts Birmingham
Barts & Royal London Great Ormond Street Middlesex Royal Marsden St Georges University College University Hospital Cambridge Cardiff Leeds Oxford Southampton Aberdeen Belfast Dublin Dundee Edinburgh Liverpool Newcastle Birmingham Derby Leicester Manchester Nottingham Norwich
15
MRD risk groups by Regimen - January 2009
Characteristics Registered MRD High risk Low risk Regimen A <10 yrs AND WCC <50 AND RER 947 264 (28%) 288 (30%) Regimen B >10 yrs or WCC >50 637 214 (34%) 155 (24%) Total 1584 478 (30%) 443 (28%)
16
Event Free Survival By Trial
100 ALL2003 (2003-) 88% ALL97-99 ( ) 80% 75 74% ALL97 ( ) PERCENT 50 25 1 2 3 4 5 TIME IN YEARS At risk: ALL97 ( ) 997 919 865 801 757 732 ALL97-99 ( ) 938 889 849 814 769 745 ALL2003 (2003-) 1828 1368 967 551 201
17
Relapse Risk By Trial ALL PATIENTS ALL97-99 (1999-2002)
100 75 No. No. Obs./ Patients Events Exp. ALL97-99 ( ) ALL97-99 ( ) 932 162 1·2 ALL2003 (2003-) 1839 70 0·7 ALL2003 (2003-) PERCENT 50 2P = 0·0001 25 16% 8% 1 2 3 4 5 TIME IN YEARS At risk: ALL97-99 ( ) 932 889 848 814 769 744 ALL2003 (2003-) 1819 1368 953 551 201
18
Event Free Survival by MRD Risk Group
LOW = 95% 100 INDETERMINATE = 85% 75 HIGH = 78% PERCENT 50 No. No. Obs./ 25 Patients Events Exp. HIGH 638 68 1·5 LOW 604 12 0·3 INDETERMINATE 738 70 1·2 1 2 3 4 5 TIME IN YEARS At risk: HIGH 638 451 317 187 68 LOW 604 467 311 184 89 3 INDETERMINATE 738 566 449 307 161 7 15-JAN-09 17:51:15
19
Proposals for ALL 2010 All patients on ALL 2020 will have therapy allocated based on MRD Treatment on ALL 2003 is currently randomised based on MRD Including risk groups A, B and C MRD Analysis done at day 28 and week 11 Sequential analysis of High Risk disease at 2 or 3 extra time-points Identification of patients with Very High Risk disease Novel therapies employed BMT?
20
Acknowledgements Members of UKMRD network: - Barts Gary Wright
Maggie Corbo Sheela Medahunsi Ulrika Johannson Susannah Akiki Bristol Jerry Hancock Paul Archer Richard Hathway Kayleigh McDonagh Paula Waits Nigel Wood Glasgow Sandra Chudleigh Mary Gardiner Frances Fee Linda Smith Nicola Craig Anne Sproul Steve McKay Sheffield Gill Wilson Helen Stuart Shilpa Haridas Amal Afifi Miranda Durkie Jane Holden Richard Kirk James Blackburn Clinical Co-ordinator: - Nick Goulden UKMRD Steering Committee:- Nick Cross Ajay Vora Brenda Gibson David Grant Christine Harrison Finbarr Cotter John Moppett CLWP and ALL Task Force ESG-MRD-ALL:- Jacques van Dongen Vincent van der Velden I-BFM MRD Group
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.