1. Are you ready for the genomic age? An introduction to human genomics Jacques Fellay EPFL School of Life Sciences Swiss Institute of Bioinformatics Lausanne, Switzerland

8. What is the genome? “It's a shop manual, with an incredibly detailed blueprint for building every human cell. It's a history book - a narrative of the journey of our species through time. It's a transformative textbook of medicine, with insights that will give health care providers new powers to treat, prevent and cure disease.” Francis Collins

9. Glossary Genome: the complete genetic constitution of an organism, encoded in nucleic acids Gene: discrete DNA sequence encoding a protein

10. 3 billions base pairs ( ATGC ) 20’000 protein-coding genes 99.6% inter-individual identity (yet 4 millions differences) 99% identical to chimpanzee genome (yet 6% different genes) The human genome

11. 2001: A Species Odyssey

12. Exploring the human genome Sanger sequencing, targeted genotyping Genome-wide genotyping (GWAS) Exome sequencing Genome sequencing 20022008

13. International HapMap Project  Identification of common genetic variation in 270 individuals from 4 populations CEU: CEPH (Utah residents with ancestry from northern and western Europe) (30 trios) CHB: Han Chinese in Beijing, China (45 individuals) JPT: Japanese in Tokyo, Japan (45 individuals) YRI: Yoruba in Ibadan, Nigeria (30 trios)

14. 1000 Genomes Project Whole genome sequencing and complete description of human genetic diversity in >1000 individuals from multiple world populations www.1000genomes.org

15. Short video – Sequencing the genome http://ed.ted.com/lessons/how-to-sequence-the- human-genome-mark-j-kiel

16. We are all different… 4 million DNA variants / individual  Single nucleotide variants  Multi-nucleotide variants Small insertions/deletions (indels) Large copy number variants (CNVs) Inversions Translocations Aneuploidy

17. Glossary SNV = single nucleotide variant: DNA sequence variation in which a single nucleotide — A, T, C or G — differs between members of the same species SNP = single nucleotide polymorphism: SNV occurring commonly within a population (> 1%)

18. SNV/SNP

19. Glossary Allele: One of a number of alternative forms of the same genetic locus (for example a SNP)

20. About 2% of people have two copies of the APOE4 allele and are very likely to succumb to Alzheimer’s disease About 1% of us have two copies of a small deletion in CCR5 and are largely immune to infection by the HIV virus And about 7% do not make any functional CYP2D6 enzyme and therefore codeine provides no pain relief

21. Glossary Linkage Disequilibrium (LD): Non-random association of alleles that descend from single, ancestral chromosomes (i.e. usually close to each other) Haplotype: Combination of alleles at adjacent locations on a chromosome that are inherited together

23. How to read the genome? GenotypingSequencing

24. Glossary Genotyping: Process of determining genetic differences between individuals by using a set of markers Sequencing: Process of determining the full nucleotide order of a DNA sequence

25. Genotyping Genome-wide chips: 500K to >1 mio single nucleotide polymorphisms (SNPs)

26. SNP output

27. Homozygous 1 Heterozygous Homozygous 2

28. Genome-wide genotyping Sequencing >5% <<<<<1% Allele frequency of variant +++ + ++ Clinical impact

30. High-throughput Sequencing (NGS) – Huge amount of data (terabytes) – Analysis computationally intensive – Dedicated IT infrastructure

31. Pipeline

32. FastQ format – single read @G:1:1:11:1079#0/1 TGATTGATTCCATTCCATTCCATTCCATTTCATTCCATTGCAATCCCTTCCAATCCATTCCATTCCATTCCATTC +G:1:1:11:1079#0/1 `Xa^YO\_^a_`__`a__^a^a^_a``^_\`\\]``[XUGXXXXXWUTWWVWUSTXXPUWYYRVWYYYXZYXYWZ A complete, high-coverage genome will have over 1 billion reads

33. Pipeline

36. http://www.ncbi.nlm.nih.gov/core/assets/variation/images/popfreq_example.jpg

37. Pipeline

38. Summary of a single human genome SNVs3.5 million Premature stop80 Stop loss10 Non-synonymous Synonymous 11,000 Essential splice site25 indels300,000 Frameshift80 In-frame200

39. Whole genome vs. exome sequencing Exome -Coding regions -Cheaper/Faster -Uneven capture of both alleles -Incomplete capture of target region -Bias towards known biology Genome -Complete sequence -Expensive/Throughput -IT issues

40. Clinical sequencing? “Sequencing of the genome or exome for clinical applications has now entered medical practice. Several thousand tests have already been ordered for patients, with the goal of establishing diagnoses for rare, clinically unrecognizable, or puzzling disorders that are suspected to be genetic in origin.” Leslie G. Biesecker and Robert C. Green, NEJM, 19 June 2014

41. Clinical sequencing? TODAY Rare functional variants (Mendelian diseases) Pharmacogenetic variants (150 gene-drug pairs in the FDA “Table of Pharmacogenomic Biomarkers in Drug Labels”, but only 40 genes involved) Oncogenomics

43. IL28B genotype and response to anti-hepatitis C treatment Ge, Fellay et al. Nature 2009

44. Clinical sequencing? TOMORROW Neonatal sequencing Maternal blood sequencing DTC genomics brought to doctors

46. Clinical sequencing? LATER Complex trait genomics (genome data in every health record) – will depend on in- depth understanding of functional genomic variation

47. Eric Green et al., Charting a course for genomic medicine from base pairs to bedside, Nature 2011 A revolution in the making

48. Perspective Genomic-based medicine is around the corner Considerable space for new (personal) genomic market in health, nutrition, well-being… Genomic-based medicine is only the beginning of “big-data-based” personalized healthcare

49. Perspective None of this can happen without trust