Presentation is loading. Please wait.

Presentation is loading. Please wait.

The Human Genome Project at UC Santa Cruz Phoenix Eagleshadow November 9, 2004.

Similar presentations


Presentation on theme: "The Human Genome Project at UC Santa Cruz Phoenix Eagleshadow November 9, 2004."— Presentation transcript:

1 The Human Genome Project at UC Santa Cruz Phoenix Eagleshadow November 9, 2004

2 The Human Genome Project Began in 1990 The Mission of the HGP: The quest to understand the human genome and the role it plays in both health and disease. “The true payoff from the HGP will be the ability to better diagnose, treat, and prevent disease.” --- Francis Collins, Director of the HGP and the National Human Genome Research Institute (NHGRI)

3 The genome is our Genetic Blueprint Nearly every human cell contains 23 pairs of chromosomes –1 - 22 and XY or XX XY = Male XX = Female Length of chr 1-22, X, Y together is ~3.2 billion bases (about 2 meters diploid)

4 The Genome is Who We Are on the inside! Chromosomes consist of DNA –molecular strings of A, C, G, & T –base pairs, A-T, C-G Genes –DNA sequences that encode proteins –less than 3% of human genome Information coded in DNA

5 CACACTTGCATGTGAGAGCTTCTAATATCTAAATTAATGTTGAATCATTATTCAGAAACAGAGAGCTAACTGTTATCCCATCCTGACTTTATTCTTTATG AGAAAAATACAGTGATTCC AAGTTACCAAGTTAGTGCTGCTTGCTTTATAAATGAAGTAATATTTTAAAAGTTGTGCATAAGTTAAAATTCAGAAATAAAACTTCATCCTAAAACTCTGTGTGTTGCTTTAAATAATC AGAGCATCTGC TACTTAATTTTTTGTGTGTGGGTGCACAATAGATGTTTAATGAGATCCTGTCATCTGTCTGCTTTTTTATTGTAAAACAGGAGGGGTTTTAATACTGGAGGAACAA CTGATGTACCTCTGAAAAGAGA AGAGATTAGTTATTAATTGAATTGAGGGTTGTCTTGTCTTAGTAGCTTTTATTCTCTAGGTACTATTTGATTATGATTGTGAAAATAGAATTTATCC CTCATTAAATGTAAAATCAACAGGAGAATAGCAAAAACTTATGAGATAGATGAACGTTGTGTGAGTGGCATGGTTTAATTTGTTTGGAAGAAGCACTTGCCCCAGAAGATACACAAT GAAATTCATGTTATTGAGTAGAGTAGTAATACAGTGTGTTCCCTTGTGAAGTTCATAACCAAGAATTTTAGTAGTGGATAGGTAGGCTGAATAACTGACTTCCTATC ATTTTCAGGTT CTGCGTTTGATTTTTTTTACATATTAATTTCTTTGATCCACATTAAGCTCAGTTATGTATTTCCATTTTATAAATGAAAAAAAATAGGCACTTGCAAATGTCAGATCACTTGCCTGTGGT CATTCGGGTAGAGATTTGTGGAGCTAAGTTGGTCTTAATCAAATGTCAAGCTTTTTTTTTTCTTATAAAATATAGGTTTTAATATGAGTTTTAAAATAAAATTAATTAGAAAAAGGCAA ATTACTCAATATATATAAGGTATTGCATTTGTAATAGGTAGGTATTTCATTTTCTAGTTATGGTGGGATATTATTCAGACTATAATTCCCAATGAAAAAACTTTAAAAAATGCTAGTGA TTGCACACTTAAAACACCTTTTAAAAAGCATTGAGAGCTTATAAAATTTTAATGAGTGATAAAACCAAATTTGAAGAGAAAAGAAGAACCCAGAGAGGTAAGGATATAACCTTACC AGTTGCAATTTGCCGATCTCTACAAATATTAATATTTATTTTGACAGTTTCAGGGTGAATGAGAAAGAAACCAAAACCCAAGACTAGCATATGTTGTCTTCTTAAGGAGCCCTCCCCT AAAAGATTGAGATGACCAAATCTTATACTCTCAGCATAAGGTGAACCAGACAGACCTAAAGCAGTGGTAGCTTGGATCCACTACTTGGGTTTGTGTGTGGCGTGACTCAGGTAATCT CAAGAATTGAACATTTTTTTAAGGTGGTCCTACTCATACACTGCCCAGGTATTAGGGAGAAGCAAATCTGAATGCTTTATAAAAATACCCTAAAGCTAAATCTTACAATATTCTCAAG AACACAGTGAA ACAAGGCAAAATAAGTTAAAATCAACAAAAACAACATGAAACATAATTAGACACACAAAGACTTCAAACATTGGAAAATACCAGAGAAAGATAATAAATAT TTTACTCTTTAAAAATTTAGTTAAAAGCTTAAACTAATTGTAGAGAAAA AACTATGTTAGTATTATATTGTAGATGAAATAAGCAAAACATTTAAAATACAAATGTGATTACTTAAAT TAAATATAATAGATAATTTACCACCAGATTAGATACCATTGAAGGAATAATTAATATACTGAAATACAGGTCAGTAGAATTTTTTTCAATTCAGCATGGAGATGTAAAAAATGAAAA TTAATGCAAAAAATAAGGGCACAAAAAGAAATGAGTAATTTTGATCAGAAATGTATTAAAATTAATAAACTGGAAATTTGACATTTAAAAAAAGCATTGTCATCCAAGTAGATGTG TCTATTAAATAGTTGTTCTCATATCCAGTAATGTAATTATTATTCCCTCTCATGCAGTTCAGATTCTGGGGTAATCTTTAGACATCAGTTTTGTCTTTTATATTATTTATTCTGTTTACTAC ATTTTATTTTGCTAATGATATTTTTAATTTCTGACATTCTGGAGTATTGCTTGTAAAAGGTATTTTTAAAAATACTTTATGGTTATTTTTGTGATTCCTATTCCTCTATGGACACCAAGGCT ATTGACATTTTCTTTGGTTTCTTCTGTTACTTCTATTTTCTTAGTGTTTATATCATTTCATAGATAGGATATTCTTTATTTTTTATTTTTATTTAAATATTTGGTGATTCTTGGTTTTCTCAGCC ATCTATTGTCAAGTGTTCTTATTAAGCATTATTATTAAATAAAGATTATTTCCTCTAATCACATGAGAATCTTTATTTCCCCCAAGTAATTGAAAATTGCAATGCCATGCTGCCATGTGG TACAGCATGGGTTTGGGCTTGCTTTCTTCTTTTTTTTTTAACTTTTATTTTAGGTTTGGGAGTACCTGTGAAAGTTTGTTATATAGGTAAACTCGTGTCACCAGGGTTTGTTGTACAGATCA TTTTGTCACCTAGGTACCAAGTACTCAACAATTATTTTTCCTGCTCCTCTGTCTCCTGTCACCCTCCACTCTCAAGTAGACTCCGGTGTCTGCTGTTCCATTCTTTGTGTCCATGTGTTCTC ATAATTTAGTTCCCCACTTGTAAGTGAGAACATGCAGTATTTTCTAGTATTTGGTTTTTTGTTCCTGTGTTAATTTGCCCAGTATAATAGCCTCCAGCTCCATCCATGTTACTGCAAAGAA CATGATCTCATTCTTTTTTATAGCTCCATGGTGTCTATATACCACATTTTCTTTATCTAAACTCTTATTGATGAGCATTGAGGTGGATTCTATGTCTTTGCTATTGTGCATATTGCTGCAAG AACATTTGTGTGCATGTGTCTTTATGGTAGAATGATATATTTTCTTCTGGGTATATATGCAGTAATGCGATTGCTGGTTGGAATGGTAGTTCTGCTTTTATCTCTTTGAGGAATTGCCATG CTGCTTTCCACAATAGTTGAACTAACTTACACTCCCACTAACAGTGTGTAAGTGTTTCCTTTTCTCCACAACCTGCCAGCATCTGTTATTTTTTGACATTTTAATAGTAGCCATTTTAACT GGTATGAAATTATATTTCATTGTGGTTTTAATTTGCATTTCTCTAATGATCAGTGATATTGAGTTTGTTTTTTTTCACATGCTTGTTGGCTGCATGTATGTCTTCTTTTAAAAAGTGTCTGTT CATGTACTTTGCCCACATTTTAATGGGGTTGTTTTTCTCTTGTAAATTTGTTTAAATTCCTTATAGGTGCTGGATTTTAGACATTTGTCAGACGCATAGTTTGCAAATAGTTTCTCCCATTC TGTAGGTTGTCTGTTTATTTTGTTAATAGTTTCTTTTGCTATGCAGAAGCTCTTAATAAGTTTAATGAGATCCTGATATGTTAGGCTTTGTGTCCCCACCCAAATCTCATCTTGAATTATA TCTCCATAATCACCACATGGAGAGACCAGGTGGAGGTAATTGAATCTGGGGGTGGTTTCACCCATGCTGTTCTTGTGATAGTGAATGAGTTCTCACGAGATCTAATGGTTTTATGAGG GGCTCTTCCCAGCTTTGCCTGGTACTTCTCCTTCCTGCCGCTTTGTGAAAAAGGTGCATTGCGTCCCTTTCACCTTCTTCTATAATTGTAAGTTTCCTGAGGCCTTCCCAGCCATGCTGAA CTTCAAGTCAATTAAACCTTTTTCTTTATAAATTACTCAGTCTCTGGTGGTTCTTTATAGCAGTGTGAAAATGGACTAATGAAGTTCCCATTTATGAATTTTTGCTTTTGTTGCAATTGCTT TTGACATCTTAGTCATGAAATCCTTGCCTGTTCTAAGTACAGGACGGTATTGCCTAGGTTGTCTTCCAGGGTTTTTCTAATTTTGTGTTTTGCATTTAAGTGTTTAATCCATCTTGAGTTGA TTTTTGTATATTGTGTAAGGAAGGGGTCCAGTTTCAATCTTTTGCATATGGCTAGTTAGTTATCCCAGTACCATTTATTGAAAAGACAGTCTTTTCCCCATCGCTCGTTTTTGTCAGTTTT ATTGATGATCAGATAATCATAGCTGTGTGGCTTTATTTCTGGGTTCTTTATTCTGTTCTATTGGTTTATGTCCCTGTTTTTGTGCCAGTACCATGCTGTTTTGGTTAACATAGCCCTGTAGT ATAGTTTGAGGTCAGATAGCCTGATGCTTCCAGCTTTGTTCTTTTTCTTAAGATTGCCTTGGCTATTTGGCCTCTTTTTTGGTTCCACATGAATTTTAAAACAGTTGTTTCTAGTTTTTGAA GAATGTCATTGGTAGTTTGATAGAAATAGCATTTAATCTGTAAATTGATTTGTGCAGTATGGCCTTTTAATGATATTGATTCTTCCTATCCATGAGCATGATATGTTTTCCATTTTGTTTG TATCCTCTCTGATTTCTTTGTGCAGTGTTTTGTAATTCTCAT TGTAGAGATTTTTCACCTCCCTGGTTAGTTGTATTTTACCCTAGATATTT TATTCTTTTTGTGAAAATTGTGAATGGGAT TGCCTTCCTGATTTGACTGC CAGCTTGGTTACTGTTGGTTTATAGAAATGCTAGTGATTTTTGTACATTG ATTTTCTTTCTAAAACTTTGCTGAAGTTTTTTTTATTAGCAGAAGGAGCT TTGGGGCTGAGACTATGGGGTTTTCTAGATATAGAATCATGTCAGCTTCAAATAGGGATAATTTTACTTCCTCTCTTCCTATTTGGATGCCCTTTATTTCTTTCTCTTGCCTGATTACTCTG GCTGGGATTTCCTATGTTGAATAGGAGT CATGAGAGAGGGCATCAAATCTACACATATCAAATACTAACCTTGAATGTCTAGATATTT TATTCTTTTTGTGAAAATTGTGAATGGGAT 5000 bases per page

6 How much data make up the human genome? 3 pallets with 40 boxes per pallet x 5000 pages per box x 5000 bases per page = 3,000,000,000 bases! To get accurate sequence requires 6-fold coverage. Now: Shred 18 pallets and reassemble.

7 The Beginning of the Project Most the first 10 years of the project were spent improving the technology to sequence and analyze DNA. Scientists all around the world worked to make detailed maps of our chromosomes and sequence model organisms, like worm, fruit fly, and mouse.

8 UC Santa Cruz gets Involved Computational biology (or Bioinformatics) is a research field that uses computers to help solve biological problems Because of the work Professor David Haussler was doing in the field of computational biology, UC Santa Cruz was invited to participate in the HGP in late of 1999.

9 The Tech Awards honors the UCSC Genome Bioinformatics Group in 2003!

10 The Challenges were Overwhelming First there was the Assembly The DNA sequence is so long that no technology can read it all at once, so it was broken into pieces. There were millions of clones (small sequence fragments). The assembly process included finding where the pieces overlapped in order to put the draft together. 3,200,000 piece puzzle anyone?

11 Assembly generated by UCSC Freeze of sequence data generated by NCBI Clone layouts generated By Washington University ACCTTGG CCTGAAT CTAGGCT TTGCATC CCTAGTC CTGATCG sequenceClone maps Working draft assembly The “Working Draft” of the human genome

12 UCSC put the human genome sequence on the web July 7, 2000 UCSC put the human genome sequence on CD in October 2000, with varying results Cyber geeks Searched for hidden Messages, and “GATTACA”

13 The Completion of the Human Genome Sequence June 2000 White House announcement that the majority of the human genome (80%) had been sequenced (working draft). Working draft made available on the web July 2000 at genome.ucsc.edu. Publication of 90 percent of the sequence in the February 2001 issue of the journal Nature. Completion of 99.99% of the genome as finished sequence on July 2003.

14 The Project is not Done… Next there is the Annotation: The sequence is like a topographical map, the annotation would include cities, towns, schools, libraries and coffee shops! So, where are the genes? How do genes work? And, how do scientists use this information for scientific understanding and to benefit us?

15 What do genes do anyway? We only have ~27,000 genes, so that means that each gene has to do a lot. Genes make proteins that make up nearly all we are (muscles, hair, eyes). Almost everything that happens in our bodies happens because of proteins (walking, digestion, fighting disease). Eye Color and Hair Color are determined by genes OR

16 Of Mice and Men: It’s all in the genes Humans and Mice have about the same number of genes. But we are so different from each other, how is this possible? One human gene can make many different proteins while a mouse gene can only make a few! Did you say cheese? Mmm, Cheese!

17 Genes are important By selecting different pieces of a gene, your body can make many kinds of proteins. (This process is called alternative splicing.) If a gene is “expressed” that means it is turned on and it will make proteins.

18 What we’ve learned from our genome so far… There are a relatively small number of human genes, less than 30,000, but they have a complex architecture that we are only beginning to understand and appreciate. -We know where 85% of genes are in the sequence. -We don’t know where the other 15% are because we haven’t seen them “on” (they may only be expressed during fetal development). -We only know what about 20% of our genes do so far. So it is relatively easy to locate genes in the genome, but it is hard to figure out what they do.

19 How do scientists find genes? The genome is so large that useful information is hard to find. Researchers at UCSC decided to make a computational microscope to help scientists search the genome. Just as you would use “google” to find something on the internet, researchers can use the “UCSC Genome Browser” to find information in the human genome. Explore it at http://genome.ucsc.edu

20 The UCSC Genome Browser

21 The browser takes you from early maps of the genome...

22 ... to a multi-resolution view...

23 ... at the gene cluster level...

24 ... the single gene level...

25 ... the single exon level...

26 ... and at the single base level caggcggactcagtggatctggccagctgtgacttgacaag caggcggactcagtggatctagccagctgtgacttgacaag

27 The Continuing Project Finding the complete set of genes and annotating the entire sequence. Annotation is like detailing; scientists annotate sequence by listing what has been learn experimentally and computationally about its function. Proteomics is studying the structure and function of groups of proteins. Proteins are really important, but we don’t really understand how they work. Comparative Genomics is the process of comparing different genomes in order to better understand what they do and how they work. Like comparing humans, chimpanzees, and mice that are all mammals but all very different.

28 Who works on this stuff anyway? Biologists and Chemists understand the physical sciences-they take biology and chemistry classes. Computer Scientists program the computers (the same people who make video games!)-they take math and computer classes. Computer Engineers try to build better, faster, smarter computers-they take math, physics and computer classes. Social Scientists try to understand how this new information and technology will impact our lives- they take sociology and philosophy classes.

29 UCSC Summer Workshop on Human Genome Research Held annually in July It’s a free event for students and teachers Workshops by faculty and researchers on a wide array of topics Tours of our laboratories and kilocluster Free breakfast and lunch Travel funds are available RSVP: 831-459-1702 or phoenix@soe.ucsc.edu

30 How can I work on this project, or something like it? Read about it, online at www.genome.gov, or in Nature, Science, or other scientific magazines.www.genome.gov Take classes in biology, chemistry, math, physics and English classes at high school. OR take classes at your local community college or University-Extension in biology, bioinformatics, or genetics. Go to college and get a degree in science, engineering, math, or social sciences.

31 Bioinformatics Opportunities Entry-Level - Company National Laboratory Teaching – Private Schools BS (BA) MS (MA) Research Staff - Company/University National Laboratory Research Foundation Teaching - Community College Public Schools PhD Director/Professor - University Company National Laboratory Research Foundation Bioinformatics Biochemistry Biology Computer Science Computer Engineering Mathematics Ocean Sciences Physics (Education, Sociology, Philosophy, Psychology, Community Studies) A research degree in any of these majors will take you far!

32 Thank you for letting us come talk to you today and share what we do! Bye! Come to UCSC, Slugs are cool!


Download ppt "The Human Genome Project at UC Santa Cruz Phoenix Eagleshadow November 9, 2004."

Similar presentations


Ads by Google