Download presentation
Published byZayne Sommerfeld Modified over 9 years ago
1
Recombination and genetic variation – models and inference
Simon Myers Department of Statistics, Oxford
2
What does recombination do to genetic variation?
Informally, recombination shuffles up genetic diversity We can see the effect of recombination in how ‘structured’ genetic variation is Chromosomes Sites Xq13: 10kb 69 worldwide Lipoprotein Lipase: 10kb 48 African Americans Chromosome 22: 1Mb 57 Europeans
3
Human pairwise association revisited
Data for ENR131, Chromosome 2q, Chinese and Japanese population sample (The International HapMap Consortium, Nature 2005) LD What is going on? Recombination causes the association breakdown Does the uneven pattern reflect Chance? Real strong differences in the underlying recombination rate in meiosis We will explore two approaches to find out
4
Recombination and genealogical history
Forwards in time Backwards in time Grandpaternal sequence Grandmaternal sequence x TCAGGCATGGATCAGGGAGCT TCACGCATGGAACAGGGAGCT TCAGGCATGG AACAGGGAGCT Non-ancestral genetic material G A G A
5
The ancestral recombination graph
The combined history of recombination, mutation and coalescence is described by the ancestral recombination graph Coalescence Mutation Coalescence Coalescence Mutation Coalescence Recombination Event
6
Deconstructing the ARG
7
Time T(0) T(0.5) T(1)
8
Learning about recombination
Just like there is a true genealogy underlying a sample of sequences without recombination, there is a true ARG underlying samples of sequences with recombination We can consider nonparametric and parametric ways of learning about recombination There are several useful nonparametric ways of learning about recombination which we will consider first These really only apply to species, such as humans, where we can be fairly sure that most SNPs are the result of a single ancestral mutation event This is formally called the infinite sites model
9
Why use a non-parametric approach?
Non-parametric approaches require few assumptions about evolution The infinite sites model, and that’s it! We can attempt to learn features of the history of a sample based only on this assumption Robust inference Identify – “detect” the recombination events that shaped our sample Clustering of multiple events in a region could signal a high underlying rate Some drawbacks to this approach
10
The signal of recombination?
Ancestral chromosome recombines Recurrent mutation Recombination
11
Practical: detecting recombination from DNA sequence data
Look for all pairs of “incompatible” sites Combine information across the pairs Find minimum number of intervals in which recombination events must have occurred (Hudson and Kaplan 1985): Rm
12
Recombination and genetic variation – models and inference, part II
Simon Myers Department of Statistics, Oxford
13
Example: 7q31 These results are based on a non-parametric minimum number of recombination intervals (events) Rh Myers and Griffiths (2003) – improvement over Rm but identical assumptions Results strongly suggest recombination “hotspots”
14
Example: humans vs. chimpanzees
Winckler et al. (2005)
15
Why use parametric approaches?
The infinite-sites model is not applicable to all species There are many more recombination events in the history of the sample than the non-parametric methods can ever detect Lack of mutations in the right places Recombination events completely undetectable HIV Subtype B (2kb segment) HIV Subtype C (2kb segment)
16
Modelling recombination
Model-based approaches to learning about recombination allow us to ask more detailed questions than nonparametric approaches What is the rate of recombination (as opposed to just the number of events) Is the rate of recombination across a region constant? Does gene A have a higher recombination rate than gene B? What patterns of genetic diversity might I expect to see in other samples from the same (or different) population? We need a model!
17
Adding recombination to the coalescent
Each generation, the probability of recombination between two loci is r, working in scaled time, this means that recombination occurs at rate r/2 per sequence where r = 4Ner Recombination, mutation and coalescence occur independently: Coalescence occurs as a Poisson process with rate n(n-1)/2 Recombination occurs as a Poisson process with rate nr/2 Mutations on edges added as a Poisson process with rate nq/2 The time until the next recombination or coalescence event is also a Poisson process with rate nr /2+ n(n-1)/2, and the probability that this next event is a recombination is
18
Recombination in non-ancestral material
Once a region has recombined, further recombination can occur in both ancestral lineages However, recombination in non-ancestral DNA cannot in anyway influence patterns of diversity (under a neutral model) We usually ignore such recombination events in the coalescent X X
19
Simulating histories with recombination
20
Properties of the ARG Unlike the basic coalescent, there are few results about the effects of recombination on gene genealogies that we can derive analytically For example, we cannot even calculate the expected number of recombination events in the history of a sequence Though we can show it is less than infinity! There are some useful results about how many recombination events we can see The key is that only a small minority of recombination events that occur in the history of the sample can ever be directly detected by nonparametric methods r=10, q=10 against log log sample size
21
Estimating the population recombination rate
The ideal inference procedure would calculate the likelihood of the data Need to allow recombination rate to vary ….but full-likelihood inference is effectively impossible for anything but the simplest data sets (and models) We need alternatives Calculate the probability of some summary of the data (like ABC) Approximate the coalescent model Approximate the likelihood The composite likelihood of Hudson (2001) approximates the likelihood of the full data by the product of the likelihoods for pairs of sites Not the real likelihood! Fast to calculate Allows a variable recombination rate
22
Composite likelihood estimation of 4Ner: Hudson (2001)
DlnL DlnL R R 15 7 1 2 4 3 Full likelihood Composite-likelihood approximation DlnL R
23
Fitting a variable recombination rate
Use a reversible-jump MCMC approach (Green 1995) SNP positions Cold Split blocks Hot Merge blocks Change block size Change block rate
24
Acceptance rates Hastings ratio Composite likelihood ratio Ratio of priors Jacobian of partial derivatives relating changes in parameters to sampled random numbers Include a prior on the number of change points that encourages smoothing
25
Broad scale validation: strong concordance between rates estimated from genetic variation and pedigrees 2Mb correlation between “Perlegen” and deCODE rates (Myers et al. 2005)
26
Fine-scale validation: strong concordance between fine-scale rate estimates from sperm and genetic variation 200kb region of human HLA Rates estimated from sperm Jeffreys et al (2001) Rates estimated from genetic variation McVean et al (2004) In this region at least, human recombination clusters into 1-2kb wide hotspots >90% of recombination in 6 hotspots We have also developed a specific test for hotspots, based on the same composite likelihood (likelihood ratio test)
27
Fine-scale rates across the human genome
Across chromosome12 Myers et al. (2005) Throughout the genome, human recombination clusters into narrow hotspots These explain LD breakdown sites
28
Data for ENR131, Chromosome 2q, Chinese and Japanese population sample (The International HapMap Consortium, Nature 2005)
29
Summary Both non-parametric and model based approaches allow us to ask detailed questions about recombination from population genetic data Recombination can be incorporated within the coalescent framework The population recombination rate, r=4Ner, is the key quantity in determining the effect of recombination on genetic variation Efficiently estimating recombination rates within a coalescent framework is difficult, but approximate methods have proved a powerful approach Such methods have allowed us to successfully learn about recombination rates in humans and other species, and reveal “hotspots” across genomes
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.