1. Forensic DNA Analysis (Part II)

2. Summary What is DNA? Where is DNA found in the body?
How does DNA differ among individuals?
Forensic DNA Analysis
DNA and Statistics

3. Forensic DNA Analysis

4. Reading of Chapter 13
If material is more complicated than what we cover in class, it likely won’t be on a quiz or exam.

5. Collection of Evidence
Forensic DNA Analysis
Collection of Evidence
Types of Unknown Samples:
Blood, Semen, Stains, Saliva
Hair, Tissue, Bones, Teeth
Types of Known Samples:
Blood or buccal swabs from suspect or victim or other known person

6. Beware of Contamination
Forensic DNA Analysis
Beware of Contamination
Contamination occurs when DNA from another source gets mixed in with the sample being collected.
An investigator touches, sneezes, bleeds on a sample.
Wear gloves and use disposable instruments
Package items separately.
Especially, do not mix known samples (from victim or suspect) with unknown samples.

7. Packaging Evidence Package each item individually.
Forensic DNA Analysis
Packaging Evidence
Package each item individually.
Put evidence into paper bags, not plastic.
Moisture degrades DNA; air dry samples.
Keep samples at room temperature and out of sun.

8. Brief History of DNA - (1985)
Forensic DNA Analysis > History
Brief History of DNA - (1985)
Multilocus
RFLP
Detects VNTRs:
Variable Number of
Tandem Repeats

9. Brief History of DNA (Late 80s, Early 90s)
Forensic DNA Analysis > History
Brief History of DNA (Late 80s, Early 90s)
Single locus RFLP
D2S44 probe
Lanes 6 and 10 match
Lanes 8 and 11 match

10. Brief History of DNA (Early 90s)
Forensic DNA Analysis > History
Brief History of DNA (Early 90s)
PCR Strips (DQ alpha)
6 Alleles:
1.1, 1.2, 1.3
2, 3 or 4
A person can
have one or
two of these
numbers.

11. Two main types (90s - Present):
Forensic DNA Analysis > History
Two main types (90s - Present):
Short Tandem Repeats (STRs)
Individual identification possible
Samples: Blood stains, semen
Mitochondrial DNA
Used in cases of severely degraded DNA
Individual identification not possible
Samples: Bones, hair shafts

12. Short Tandem Repeats (STRs)
Forensic DNA Analysis > STR
Short Tandem Repeats (STRs)
Currently the most used of all forensic markers
Individual identification possible
Type of data used in the FBI CODIS database
People differ in length at these loci
Are located in the nuclear DNA (chromosomes)

13. Short Tandem Repeats (STRs)
Forensic DNA Analysis > STR
Short Tandem Repeats (STRs)
Person 1 ..GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT..
Person 2 ..GCCAGCTAGCTAGCTAGCTAGCTTTCAT..
Person 3 ..GCCAGCTAGCTAGCTAGCTAGCTAGCTAGCTT..

14. CCAGATAGATAGATAGATAGATAGATAGATAGATAGATCC
Forensic DNA Analysis > STR
Locus or Loci:
Refers to the location on the chromosome.
Allele:
Refers to the type of DNA.
For STRs,
the allele will be the number of repeats.
CCAGATAGATAGATAGATAGATAGATAGATAGATAGATCC

15. Example: Locus: D5S818 Alleles: 7,9 Forensic DNA Analysis > STR
Paternal chromosome 5
CCAGATAGATAGATAGATAGATAGATAGATCC
Maternal chromosome 5
CCAGATAGATAGATAGATAGATAGATAGATAGATAGATCC

16. Forensic DNA Analysis > STR
13 loci used in CODIS

17. Basic Steps in Analysis
Forensic DNA Analysis > STR
Basic Steps in Analysis
Extraction:
Separates DNA from sample
Amplification or PCR:
Amplifies small portions of DNA (STR regions)
Separation:
Separates amplified fragments according to size.

18. Basic Steps in Analysis
Forensic DNA Analysis > STR
Basic Steps in Analysis
Extraction:
Separates DNA from sample
Amplification or PCR:
Amplifies small portions of DNA (STR regions)
Separation:
Separates amplified fragments according to size.

19. Basic Steps in Analysis
Forensic DNA Analysis > STR
Basic Steps in Analysis
Extraction:
Separates DNA from sample
Amplification or PCR:
Amplifies small portions of DNA (STR regions)
Separation:
Separates amplified fragments according to size.

20. PCR Hood

21. The Thermal Cycler
Amplifies DNA

22. Basic Steps in Analysis
Forensic DNA Analysis > STR
Basic Steps in Analysis
Extraction:
Separates DNA from sample
Amplification or PCR:
Amplifies small portions of DNA (STR regions)
Separation:
Separates amplified fragments according to size.

23. FMBIO
Separates and Measures Amplified DNA

24. Forensic DNA Analysis > STR
Color image of gel

25. Black and white image of STR gel.
Forensic DNA Analysis > STR
Gel Electrophoresis
Black and white image of STR gel.
Samples will have one or two bands at each loci.

26. Separates and Measures Amplified DNA
ABI 310 Genetic Analyzer
Separates and Measures Amplified DNA

28. Capillary Electrophoresis
Forensic DNA Analysis > STR
Capillary Electrophoresis
Sample will have one or two peaks at each loci.

29. Compare to a ladder that has all peaks at each loci.
Forensic DNA Analysis > STR
Compare to a ladder that has all peaks at each loci.

31. DNA Profiles are compared
Forensic DNA Analysis > STR
DNA Profiles are compared
TPOX CSF1PO D5S818 D8S1179
Blood stain , , , ,8
Suspect 1 8, , , ,12
Suspect , , , ,12
Suspect 3 7, , , ,8

32. DNA Profiles are compared
Forensic DNA Analysis > STR
DNA Profiles are compared
TPOX CSF1PO D5S818 D8S1179
Blood stain , , , ,8
Suspect 1 8, , , ,12
Suspect , , , ,12
Suspect 3 7, , , ,8

33. Forensic DNA (mitochondria)
Mitochondria - The powerhouse of the cell.
Mitochondria have
their own DNA
Mitochondria

34. Mitochondrial DNA Forensic DNA Analysis > Mitochondrial Ring of DNA
YES
Double Helix
YES
Chromosomes NO

35. Mitochondrial DNA is only 16,569 letters long
Forensic DNA Analysis > Mitochondrial
Mitochondrial DNA is only 16,569 letters long
[compared to 3 billion in nuclear DNA]
There is a 900 base pair region with a 1.7% difference [D loop]

36. MtDNA used for old or degraded samples
Forensic DNA Analysis > Mitochondrial
Nuclear DNA vs. Mitochondrial DNA
Double Helix
Double Helix
46 Chromosomes
One Ring
Multiple copies in each mitochondria
One copy per cell
Multiple mitochondria in each cell
MtDNA used for old or degraded samples

37. Different colored peaks correspond to a different base
Forensic DNA Analysis > Mitochondrial
Nuclear DNA: Length is measured
mtDNA: Sequence is examined
Different colored peaks correspond to a different base

38. Basic Steps in Analysis
Forensic DNA Analysis > Mitochondrial
Basic Steps in Analysis
Extraction:
Separates DNA from sample
Amplification or PCR:
Amplifies small portions of DNA (STR regions)
Sequencing:
Sequence of letters for amplified fragments

39. AGCTAGATCGTTATTCCGAG
Forensic DNA Analysis > Mitochondrial
DNA Sequences are compared
AGCTAGATCGTTATTCCGAG
Hair Sample
AGCTAGATCGTTATTCCGAG
Victim
Conclusion: Hair may have come from the victim.

40. AGCTAGATTGTTATTCCGAG
Forensic DNA Analysis > Mitochondrial
DNA Sequences are compared
AGCTAGATTGTTATTCCGAG
Hair Sample
AGCTAGATCGTTATTCCGAG
Victim
Conclusion: Hair did not come from the victim.

41. AGCTAGATTGTTATTCCGAG
Forensic DNA Analysis > Mitochondrial
DNA Sequences are compared
AGCTAGATTGTTATTCCGAG
Cigarette
AGCTAGATCGTTATTCCGAG
Suspect #1
AGCTAGATTGTTATTCCGAG
Suspect #2
AGCTTGATTGTTATTCCGAG
Suspect #3
AGCTAGATTGTTATTCCGAG
Suspect #4
Conclusion: Cigarette could be from Suspect #2, Suspect #4 or other person with the same sequence.

42. DNA and Statistics The final result is presented as a statistic.
Do not say:
“The DNA in the bloodstain is John Doe’s DNA.”
Do say:
“The chance that another person has this DNA in the bloodstain is 1 in 300 billion.”

43. Where do the statistics come from?
Forensic DNA Analysis > Statistics
Where do the statistics come from?
First, the frequency of each allele is estimated using data from a population data base.
Allele frequency
from database
Locus: D5S818
7 26%
Alleles: 7,9
9 11%

44. Where do the statistics come from?
Forensic DNA Analysis > Statistics
Where do the statistics come from?
Next, the frequency of the genotype at each locus is calculated.
Genotype
frequency
Locus: D5S818
Alleles: 7,9
7,9 6%

45. For total frequency, multiply all of the frequencies together.
Forensic DNA Analysis > Statistics
For total frequency, multiply all of the frequencies together.
D5 = 6%
D8 = 12%
D18 = 0.5%
Total = 0.004%

48. Demonstration
Calculating Frequencies