1. DNA Typing bsapp.com

2. bsapp.com

3. DNA strands come from the nucleus or the mitochondria bsapp.com

4. DNA Strands Building block of genetic makeup Building block of genetic makeup A complete copy of an individuals entire genome exist in nearly every cell A complete copy of an individuals entire genome exist in nearly every cell Each persons genome is made up of billions of base pairs Each persons genome is made up of billions of base pairs Most base pairs are “junk” DNA Most base pairs are “junk” DNA bsapp.com

5. DNA is made up of chromosomes which contain matching genes called alleles bsapp.com

6. Base pairs exist at the basic level of DNA bsapp.com

7. Base Pairs Adenine Adenine Thymine Thymine Guanine Guanine Cytosine Cytosine bsapp.com

8. Variable Number Tandem Repeaters (VNTR) Portions of DNA sequences are repeated Portions of DNA sequences are repeated These repetitions vary among individuals These repetitions vary among individuals CACATCTATCTATCTATCTATCTAT CTATCTATCTATCTATCTATTGC bsapp.com

9. Forensic DNA Testing Only one-tenth of a percent of DNA differs from one human to the next Only one-tenth of a percent of DNA differs from one human to the next This still leaves millions of bases to analyze for differences This still leaves millions of bases to analyze for differences bsapp.com

10. Types of DNA Testing PCR (Polymorphism Chain Reaction) RFLP (Restriction Fragment Length Polymorphism) STR (Short Tandem Repeat) mtDNA (Mitochondrial DNA Analysis) bsapp.com

11. PCR (Polymorphism Chain Reaction) Doesn't accomplish DNA typing Doesn't accomplish DNA typing Increases the amount of DNA available for typing by producing millions of copies Increases the amount of DNA available for typing by producing millions of copies Use to amplify tiny quantities and degraded samples Use to amplify tiny quantities and degraded samples Extremely sensitive to contamination Extremely sensitive to contamination bsapp.com

12. Basic Procedure for Typing bsapp.com

13. DNA is cut into different size VNTR’s by the use of restriction enzymes bsapp.com

14. Fragments are placed on a gel plate bsapp.com

15. Fragments are separated by electrophoresis bsapp.com

16. The DNA is then transferred from the gel plate and made visible bsapp.com

17. RFLP (Restriction Fragment Length Polymorphism) Oldest/Cheapest test Oldest/Cheapest test Requires large amounts of non- degraded DNA Requires large amounts of non- degraded DNA Utilizes the longer sequences of VNTR’s Utilizes the longer sequences of VNTR’s bsapp.com

18. STR (Short Tandem Repeat) or SSR (Simple Sequence Repeats) Used to evaluate specific regions (loci) of DNA strands Used to evaluate specific regions (loci) of DNA strands Utilizes shorter stands than VNTR’s Utilizes shorter stands than VNTR’s May by used on much smaller, older, and more degraded samples May by used on much smaller, older, and more degraded samples Usually requires PCR prior to testing Usually requires PCR prior to testing bsapp.com

19. mtDNA (Mitochondrial DNA) Uses DNA from a cellular organelle called a mitochondrion Uses DNA from a cellular organelle called a mitochondrion Mitochondrial DNA degrades at a much slower rate than nuclear DNA Mitochondrial DNA degrades at a much slower rate than nuclear DNA Allows analysis of older biological samples, such as hair and bones Allows analysis of older biological samples, such as hair and bones Not as precise as STR Not as precise as STR Extremely expensive and time consuming Extremely expensive and time consuming bsapp.com

20. Reading DNA Tests bsapp.com

21. bsapp.com

22. bsapp.com

23. bsapp.com