2. and

3. If this shoelace were a chromosome, then these two protective tips would be its

4. Copyright 2003, Randolph Femmer. All rights reserved.

5. Molecular biologists have found what may be the main “aging” clock of a cell:

6. Each time a cell divides, it LOSES a portion of its protective Watch the telomeres for your next eight clicks

7. When a cell loses its entire telomere, it faces senescence and death

8. What is going on here?

10. Imagine having a photocopy machine available to copy important documents.

11. Before a cell divides, it must make exact copies of all its genetic information.

12. Now imagine a cell and the machinery it uses to make these copies.

13. Suppose that your copy machine has an imperfection and when it copies each page, it does NOT copy the first and last sentences on the page.

14. Suppose that your copy machine has an imperfection and when it copies each page, it does NOT copy the first and last sentences on the page. Each time you have to make copies, you would LOSE more and more information!

15. Suppose that your copy machine has an imperfection and when it copies each page, it does NOT copy the first and last sentences on the page. Can you see a problem here? At some point, these losses would become very, very serious.

16. Cells experience just such a problem each time they must copy their DNA.

17. …... …... Cells experience just such a problem each time they must copy their DNA.

18. …... ….. …... ….. Cells experience just such a problem each time they must copy their DNA.

19. …... …… …... …… …... …… Cells experience just such a problem each time they must copy their DNA.

20. …… …… …… …… …… …… …… …… Cells experience just such a problem each time they must copy their DNA.

21. Molecular biologists wonder why our cells can only undergo a specific number of cell divisions before they finally senesce and die. The progressive loss of genetic ….information could be one cause of this...

22. Apparently, one of a cell’s solutions to this problem is to be found in its

23. Cells cap each end of their chromosomes with protective TELOMERES. TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG

24. TTAGGG TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG Notice that telomeres are made up of repeating sequences of TTAGGG

26. In essentially all organisms, telomeres are composed of this SAME repeating sequence. TTAGGG

27. This sequence may be repeated hundreds of times at each end of a chromosome: With each cell division, however, about 50-200 of these nucleotides are lost.

30.  They appear to function a little bit like a “hit-counter” on a web page.  Telomeres were first discovered by cancer researchers in 1961.  Each time a cell divides, part of its telomeres are lost or destroyed.

31. Eventually, a cell loses all o f the nucleotides making up its telomeres and cell division no longer occurs.

32. Now damage within the cell can slowly accumulate, eventually leading to cell senescence (“aging”) and cell death.

33. Experiments suggest that if a chromosome’s telomeres can be protected... a cell can divide almost forever. -- or restored --

34. The Immortality Enzyme Part Two

35. an enzyme known as telomerase can telomeres restore

36. Some cells appear to be “immortal.” Some cancer cells, for example, have been kept in laboratory cultures for decades -- dividing and dividing repeatedly.

37. Why are some cells“immortal” while others exhaust their potential to divide and end up aging and dying?

38. Telomerase is an enzyme that adds telomeres back onto the ends of chromosomes.

39. It is known to scientists as hTRT human Telomerase Reverse Transcriptase

40. It is an enzyme containing its own short segment of RNA which it uses as a template to to synthesize DNA sequences to be added onto the telomeres.

41. Telomeres appear to be a cellular aging “clock” that runs down more and more with each cell division.

42. In contrast, telomerase resets this clock by adding telomeres back onto the tips of the chromosomes.

43. This restores telomere length and imparts a kind of youthful “immortality” to the cell.

44. Cultures of human cells that normally divide about 60 times have been implanted with the gene that codes for telomerase -- and have already divided more than 300 times without ill effect. Other cells (from a human retina) also appear to have achieved a sort of “immortality” when implanted with telomerase genes.

45. Stover, Dawn. 1999. Fountain of Youth in Popular Science 254(2): 57-59. Kent, Saul. Telomerase: The 'Immortalizing Enzyme'

48. The Immortality Enzyme