2. AP Biology 2007-2008 From Gene to Protein How Genes Work

3. AP Biology Organelles  nucleus  ribosomes  endoplasmic reticulum (ER)  Golgi apparatus  vesicles Making proteins small ribosomal subunit large ribosomal subunit cytoplasm mRNA nuclear pore

4. AP Biology Nucleus & Nucleolus

5. AP Biology Nucleolus Function  ribosome production build ribosome subunits from rRNA & proteins exit through nuclear pores to cytoplasm & combine to form functional ribosomes small subunit large subunit ribosome rRNA & proteins nucleolus

6. AP Biology small subunit large subunit Ribosomes Function  protein production Structure  rRNA & protein  2 subunits combine 0.08  m Ribosomes Rough ER Smooth ER

7. AP Biology membrane proteins Types of Ribosomes Free ribosomes  suspended in cytosol  synthesize proteins that function in cytosol Bound ribosomes  attached to endoplasmic reticulum  synthesize proteins for export or for membranes

8. AP Biology DNA RNA ribosomes endoplasmic reticulum vesicle Golgi apparatus vesicle protein on its way! protein finished protein Making Proteins TO: nucleus TO:

9. AP Biology End of the Tour

10. AP Biology TACGCACATTTACGTACGCGGATGC CGCGACTATGATCACATAGACATGCT GTCAGCTCTAGTAGACTAGCTGACT CGACTAGCATGATCGATCAGCTACAT GCTAGCACACYCGTACATCGATCCT GACATCGACCTGCTCGTACATGCTA CTAGCTACTGACTCATGATCCAGATC ACTGAAACCCTAGATCGGGTACCTA TTACAGTACGATCATCCGATCAGATC ATGCTAGTACATCGATCGATACTGCT ACTGATCTAGCTCAATCAAACTCTTT TTGCATCATGATACTAGACTAGCTGA CTGATCATGACTCTGATCCCGTA What happens in the cell when a gene is read? Where are the genes? Where does a gene start? Where does the gene end? How do cells make proteins from DNA? How is one gene read and another one not? How do proteins create phenotype?

11. AP Biology Inheritance of metabolic diseases  suggested that genes coded for enzymes  each disease (phenotype) is caused by non-functional gene product lack of an enzyme Tay sachs PKU (phenylketonuria) albinism Am I just the sum of my proteins? Metabolism taught us about genes ABCDE disease  enzyme 1enzyme 2enzyme 3enzyme 4 metabolic pathway

12. AP Biology ingested protein phenylalanine tyrosine hydroxyphenylpyruvic acid homogentisic acid maleylacetoacetic acid CO 2 & H 2 O phenylalanine hydroxylase transaminase hydroxyphenylpyruvic acid oxidase homogentisic acid oxidase melanin thyroxine PKU phenylketonuria tyrosinosis alkaptonuria albinism cretinism digestion

13. AP Biology 1 gene – 1 enzyme hypothesis Beadle & Tatum  Compared mutants of bread mold, Neurospora fungus created mutations by X-ray treatments  X-rays break DNA  damage a gene wild type grows on minimal media  sugars + required nutrients allows fungus to synthesize essential amino acids mutants require added amino acids  each type of mutant lacks a certain enzyme needed to produce a certain amino acid  non-functional enzyme from damaged gene

14. AP Biology Wild-type Neurospora Minimal medium Select one of the spores Grow on complete medium Minimal control Nucleic acid Choline PyridoxineRiboflavin Arginine Minimal media supplemented only with… Thiamine Folic acid Niacin Inositol p-Amino benzoic acid Test on minimal medium to confirm presence of mutation Growth on complete medium X rays or ultraviolet light asexual spores Beadle & Tatum create mutations positive control negative control experimentals mutation identified amino acid supplements

15. AP Biology One gene / one enzyme hypothesis chromosome gene cluster 1 enzyme E glutamateornithinecitruline argino- succinate arginine enzyme Fenzyme Genzyme H encoded enzyme substrate in biochemical pathway gene cluster 2 gene cluster 3 arg-H arg-G arg-F arg-E Damage to specific gene, mapped to nutritional mutations gene that was damaged

16. AP Biology Beadle & Tatum 1941 | 1958 George Beadle Edward Tatum "for their discovery that genes act by regulating definite chemical events" one gene : one enzyme hypothesis

17. AP Biology The “Central Dogma” Flow of genetic information in a cell  How do we move information from DNA to proteins? transcription translation replication protein RNA DNAtrait DNA gets all the glory, but proteins do all the work!

18. AP Biology RNA ribose sugar N-bases  uracil instead of thymine  U : A  C : G single stranded lots of RNAs  mRNA, tRNA, rRNA, siRNA… RNADNA transcription

19. AP Biology 2007-2008 Transcription from DNA nucleic acid language to RNA nucleic acid language

20. AP Biology Transcription Making mRNA  transcribed DNA strand = template strand  untranscribed DNA strand = coding strand same sequence as RNA  synthesis of complementary RNA strand transcription bubble  enzyme RNA polymerase template strand rewinding mRNA RNA polymerase unwinding coding strand DNA C C C C C C C C CC C G G G G GG GG G G G A A A AA A A A A A A A A T T T T T T T T T T T T UU 5 3 5 3 3 5 build RNA 5  3

21. AP Biology 2007-2008 Transcription in Prokaryotes Bacterial chromosome mRNA Cell wall Cell membrane Transcription Psssst… no nucleus!

22. AP Biology Transcription in Prokaryotes Initiation  RNA polymerase binds to promoter sequence on DNA Role of promoter Starting point  where to start reading  start of gene Template strand  which strand to read Direction on DNA  always read DNA 3  5  build RNA 5  3

23. AP Biology Transcription in Prokaryotes Promoter sequences RNA polymerase molecules bound to bacterial DNA TATAAT RNA polymerase Promoter enzyme subunit bacterial DNA –35 sequence –10 sequence TTGACA RNA polymerase strong vs. weak promoters read DNA 3  5

24. AP Biology Transcription in Prokaryotes Simple proofreading 1 error/10 5 bases make many mRNAs mRNA has short life not worth editing! Elongation  RNA polymerase copies DNA as it unwinds ~20 base pairs at a time  300-500 bases in gene builds RNA 5  3 reads DNA 3  5

25. AP Biology Transcription in Prokaryotes Termination  RNA polymerase stops at termination sequence RNA GC hairpin turn

26. AP Biology 2007-2008 Transcription in Eukaryotes Protein RNA Processing Translation Transcription Psssst… DNA can’t leave nucleus!

27. AP Biology Prokaryote vs. Eukaryote genes Prokaryotes  DNA in cytoplasm  circular chromosome  naked DNA  no introns Eukaryotes  DNA in nucleus  linear chromosomes  DNA wound on histone proteins  introns vs. exons eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence introns come out!

28. AP Biology Transcription in Eukaryotes 3 RNA polymerase enzymes  RNA polymerase 1 only transcribes rRNA genes makes ribosomes  RNA polymerase 2 transcribes genes into mRNA  RNA polymerase 3 only transcribes tRNA genes  each has a specific promoter sequence it recognizes

29. AP Biology Transcription in Eukaryotes Initiation complex  transcription factors bind to promoter region upstream of gene suite of proteins which bind to DNA  turn on or off transcription TATA box binding site  recognition site for transcription factors  transcription factors trigger the binding of RNA polymerase to DNA

30. AP Biology A A A A A 3' poly-A tail mRNA 5' 5' cap 3' G P P P 50-250 A’s Post-transcriptional processing eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence primary mRNA transcript mature mRNA transcript pre-mRNA spliced mRNA Primary transcript (pre-mRNA)  eukaryotic mRNA needs work after transcription mRNA processing (making mature mRNA)  mRNA splicing = edit out introns  protect mRNA from enzymes in cytoplasm add 5 cap add polyA tail ~10,000 bases ~1,000 bases

31. AP Biology 1977 | 1993 Richard Roberts Philip Sharp CSHL MIT adenovirus common cold Discovery of Split genes beta-thalassemia

32. AP Biology Splicing must be accurate No room for mistakes!  splicing must be exactly accurate  a single base added or lost throws off the reading frame AUG|CGG|UCC|GAU|AAG|GGC|CAU AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU Met|Arg|Ser|Asp|Lys|Gly|His Met|Arg|Val|Arg|STOP|

33. AP Biology Splicing enzymes snRNPs exon intron snRNA 5'3' spliceosome exon excised intron 5' 3' lariat exon mature mRNA 5' No, not smurfs! “snurps” snRNPs  small nuclear RNA  proteins Spliceosome  several snRNPs  recognize splice site sequence cut & paste Whoa! I think we just broke a biological “rule”!

34. AP Biology Ribozyme Sidney AltmanThomas Cech 1982 | 1989 YaleU of Colorado RNA as ribozyme  some mRNA can even splice itself  RNA as enzyme

35. AP Biology 2007-2008 Translation from nucleic acid language to amino acid language

36. AP Biology 2007-2008 Translation in Prokaryotes Bacterial chromosome mRNA Cell wall Cell membrane Transcription Translation protein Psssst… no nucleus!

37. AP Biology Transcription & translation are simultaneous in bacteria  DNA is in cytoplasm  no mRNA editing  ribosomes read mRNA as it is being transcribed Translation in Prokaryotes

38. AP Biology Translation: prokaryotes vs. eukaryotes Differences between prokaryotes & eukaryotes  time & physical separation between processes takes eukaryote ~1 hour from DNA to protein  RNA processing

39. AP Biology 2007-2008 Translation in Eukaryotes

40. AP Biology mRNA From gene to protein DNA transcription nucleus cytoplasm mRNA leaves nucleus through nuclear pores proteins synthesized by ribosomes using instructions on mRNA a a a a a a aa ribosome protein translation

41. AP Biology How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? 4 4 20 ATCG AUCG

42. AP Biology AUGCGUGUAAAUGCAUGCGCC mRNA mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? codon

43. AP Biology Cracking the code 1960 | 1968 Crick  determined 3-letter (triplet) codon system Nirenberg & Khorana WHYDIDTHEREDBATEATTHEFATRAT Nirenberg (47) & Khorana (17)  determined mRNA–amino acid match  added fabricated mRNA to test tube of ribosomes, tRNA & amino acids created artificial UUUUU… mRNA found that UUU coded for phenylalanine (phe)

44. AP Biology 1960 | 1968 Marshall Nirenberg Har Khorana

45. AP Biology The code Code for ALL life!  strongest support for a common origin for all life Code is redundant  several codons for each amino acid  3rd base “wobble” Start codon  AUG  methionine Stop codons  UGA, UAA, UAG Why is the wobble good?

46. AP Biology How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA amino acid tRNA anti-codon codon 53 35 35 UAC Met GCA Arg CAU Val

47. AP Biology mRNA From gene to protein DNA transcription nucleus cytoplasm a a a a a a aa ribosome protein translation

48. AP Biology Transfer RNA structure “Clover leaf” structure  anticodon on “clover leaf” end  amino acid attached on 3 end

49. AP Biology Loading tRNA Aminoacyl tRNA synthetase  enzyme which bonds amino acid to tRNA  bond requires energy ATP  AMP  energy stored in tRNA-amino acid bond unstable so it can release amino acid at ribosome easily activating enzyme anticodon tRNA Trp binds to UGG condon of mRNA Trp mRNA ACC UGG C=O OH H2OH2O O tRNA Trp tryptophan attached to tRNA Trp C=O O

50. AP Biology Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon  organelle or enzyme? Structure  ribosomal RNA (rRNA) & proteins  2 subunits large small EP A

51. AP Biology Ribosomes Met 5' 3' U U A C A G APE A site (aminoacyl-tRNA site)  holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site)  holds tRNA carrying growing polypeptide chain E site (exit site)  empty tRNA leaves ribosome from exit site

52. AP Biology Building a polypeptide Initiation  brings together mRNA, ribosome subunits, initiator tRNA Elongation  adding amino acids based on codon sequence Termination  end codon 123 Leu tRNA Met PEA mRNA 5' 3' U U A A A A C C C AU U G G G U U A A A A C C C A U U G G G U U A A A A C C C A U U G G G U U A A A C C A U U G G G A C Val Ser Ala Trp release factor A AA CC UUGG 3'

53. AP Biology Protein targeting Signal peptide  address label Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… start of a secretory pathway

54. AP Biology Can you tell the story? DNA pre-mRNA ribosome tRNA amino acids polypeptide mature mRNA 5' cap polyA tail large ribosomal subunit small ribosomal subunit aminoacyl tRNA synthetase EPA 5' 3' RNA polymerase exon intron tRNA

55. AP Biology 2007-2008 Got Questions? Can I translate that for you?

56. AP Biology 2007-2008 Substitute Slides for Student Print version

57. AP Biology Can you tell the story?

58. AP Biology 2007-2008 Extra Slides (used some years & not others)

59. AP Biology Translation Codons  blocks of 3 nucleotides decoded into the sequence of amino acids

60. AP Biology Building Proteins Organelles involved  nucleus  ribosomes  endoplasmic reticulum (ER)  Golgi apparatus  vesicles nucleusribosomeER Golgi apparatus vesicles The Protein Assembly Line

61. AP Biology From nucleus to cytoplasm… Where are the genes?  genes are on chromosomes in nucleus Where are proteins synthesized?  proteins made in cytoplasm by ribosomes How does the information get from DNA in nucleus to cytoplasm?  messenger RNA nucleus

62. AP Biology Alternative splicing Alternative mRNAs produced from same gene  when is an intron not an intron…  different segments treated as exons Starting to get hard to define a gene!

63. AP Biology Domains Modular architecture of many proteins  exons may represent functional units of protein  easier to mix and match in the production of new proteins?

64. AP Biology So… What is a gene? One gene – one enzyme?  but not all proteins are enzymes  but all proteins are coded by genes One gene – one protein?  but many proteins are composed of several polypeptides  but each polypeptide has its own gene One gene – one polypeptide?  but many genes only code for RNA (tRNA, rRNA…) One gene – one product?  but many genes code for more than one product … So… Where does that leave us?!

65. AP Biology Defining a gene… “Defining a gene is problematic because… one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there are many other complications.” – Elizabeth Pennisi, Science 2003 gene polypeptide 1 polypeptide 2 polypeptide 3 RNA gene It’s hard to hunt for wabbits, if you don’t know what a wabbit looks like.

66. AP Biology TACGCACATTTACGTACGCGGATGCCGCGACT ATGATCACATAGACATGCTGTCAGCTCTAGTAG ACTAGCTGACTCGACTAGCATGATCGATCAGC TACATGCTAGCACACYCGTACATCGATCCTGA CATCGACCTGCTCGTACATGCTACTAGCTACTG ACTCATGATCCAGATCACTGAAACCCTAGATC GGGTACCTATTACAGTACGATCATCCGATCAGA TCATGCTAGTACATCGATCGATACTGCTACTGA TCTAGCTCAATCAAACTCTTTTTGCATCATGAT ACTAGACTAGCTGACTGATCATGACTCTGATCC CGTAGATCGGGTACCTATTACAGTACGATCATC CGATCAGATCATGCTAGTACATCGATCGATACT GCTACTGATCTAGCTCAATCAAACTCTTTTTGC ATCATGATACTAGACTAGCTGACTGATCATGAC TCTGATCCCGTAGATCGGGTACCTATTACAGTA CGATCATCCGATCAGATCATGCTAGTACATCGA TCGATACT human genome 3.2 billion bases

67. AP Biology AAAAAAAAGTP 20-30b 3' promoter transcription stop transcription start introns The Transcriptional unit (gene?) transcriptional unit TACACT DNA TATA 5' RNA polymerase pre-mRNA 5'3' translation start translation stop mature mRNA 5'3' UTR exons enhancer 1000 + b

68. AP Biology 2007-2008 Any Questions?? What color would a smurf turn if he held his breath?

69. AP Biology 20-30b 3' introns The Transcriptional unit transcriptional unit TACACT DNATATA 5' RNA polymerase 5'3' 5'3' exons enhancer 1000 + b