Download presentation
Presentation is loading. Please wait.
Published byMaegan Ridge Modified over 9 years ago
1
Presented By Dr. Shazzad Hosain Asst. Prof. EECS, NSU Multiple Sequence Alignment Motif Finding and Gene Prediction
2
What is a Multiple Sequence Alignment? characterize protein families by identify shared regions of homology molecular evolution analysis using Phylogenetic methods tell us something about the evolution of organisms Homologous genes (genes with share evolutionary origin) have similar sequences Uncover changes in gene structure Look for evidence of selection
3
Motivation Let n number of sequences A new sequence i.e. gene/protein comes up Wants to find its family
4
Methods of MSA Exact method Heuristic methods
5
Exact method Sequence Alignment (two sequences) 0-2-4-6-8-10 -2 -4 -6 A C G T A AGTAGT F(i, j) = F(i-1, j-1) + s(x i,y j ) F(i, j) = max F(i, j) = F(i-1, j) - d F(i, j) = F(i, j-1) - d 2 0 0
6
Exact method (Dynamic Programming) VSN — S S — NA— AS——— VSNS S N A A S Start
7
Dynamic Programming for Three Sequences There are 7 ways to get to C[i,j,k] C[i,j,k] C[i-1,j-1,k-1] C[i-1,j,k-1] For 3 seqs. of length n, time is proportional to n 3 Enumerate all possibilities and choose the best one
8
Dynamic programming cont. More then three sequences Four dimension No deterministic polynomial time algorithm to find optimal solution MSA complexity is NP So, Heuristics algorithms for near optimal solution
9
Heuristics for MSA Iterative pair-wise alignment Motif / Anchor – based alignment Divide and conquer AlgorithmDivide and conquer Algorithm Statistical methods like Hidden Markov ModelStatistical methods like Hidden Markov Model
10
Divide and Conquer Algorithm
11
Iterative Pairwise Alignment Let four strings to align MASH, MESH, SQUASH, SQUAMISH MASHMESH M_ _ASH M_ _ESH SQUASH M_ _A_ _SH M_ _E_ _SH SQUA_ _SH SQUAMISH
12
Iterative Pairwise Alignment cont. In other way MASHMESHSQUAMISH SQUA_ _SH SQUAMISH _M_A _ _SH _M_E _ _SH
13
Regulatory Motifs in DNA Sequences
14
The Immune system Immunity genes are usually dormant When infected, somehow get switched on When these genes are turned on, they produce proteins that destroy the pathogen, usually curing the infection
15
Immune System in Fruit Flies Fruit flies do not have sophisticated immune system as humans Have small set of immunity genes, usually dormant But when infected, somehow get switched on For fruit flies, let we like to know which genes are switched on as an immune response
16
Regulatory Motif Regulatory motif is a short sequence of string, where the transcription factors, a protein that encourages RNA polymerase to transcribe the downstream genes, bind Regulatory motif triggers gene activation Also known as NF-κB binding sites Immunity genes in fruit fly genome have strings that are reminiscent of TCGGGGATTTCC ACGTCGCGTACGTAAACGCTCGCTAAACGCTCGCTAAACGCTCGCT Regulatory Motif Upstream downstream
17
The Fruit Fly Experiment Which genes are switched on as an immune response? – Infect the fly, grind it up, collect a set of upstream regions form the genes in the genome – Each region contains at least one NF-κB binding sites NF-κB (nuclear factor kappa-light-chain-enhancer of activated B cells) is a protein complex that controls the transcription of DNAtranscriptionDNA – Suppose we do not know what the NF-κB pattern looks like, nor do the position – So, given a set of sequences from a genome, can we find short substrings that seem to occur surprisingly often.
18
Profiles
21
Profile Matrix
22
Motif Finding Problem
23
Gene Prediction Problem
24
Genome Complexities Human genome is larger than bacterial genomes, seems logical But Salamander genome is ten times larger than the human genome – Junk DNA or introns are more in Salamander
25
cDNA Problem cDNA
26
Similar genes Across species
27
Genome Complexities Jumps are inconsistent across species A gene in an insect edition is differently organized than a related gene in a worm genome The number of parts (exons) may be different Information that appears in one part of human edition may be broken up into two in the mouse version or vice versa So, quite different in terms of part structure. Does it mean intron exon lengths are same across species?
28
Genome Complexities Human genes constitute only 3% of the human genome No existing in silico gene recognition algorithm provides completely reliable gene recognition. Roughly two approaches of gene prediction – Statistical methods – Similarity based approach
29
Similarity Based Approach The Exon Chaining Problem This approach uses previously sequenced genes and their protein products as a template Find a set of potential exons, putative exons, by local alignment The exon set may be overlapping The problem is to choose the best subset of non- overlapping substrings as a putative exon structure
30
Putative Exon Model Let (l, r, w) describe an exon that starts at l th position, ends at r th position and has w weight w may reflect local alignment score or any other measures (2, 3, 3) (7, 17, 12)
31
Putative Exon Model Let (l, r, w) describe an exon that starts at l th position, ends at r th position and has w weight w may reflect local alignment score or any other measures 0000000000000000 or i is the current location j is the left end of the current location 3 5 6 1 10 7 12 4
32
Putative Exon Model Let (l, r, w) describe an exon that starts at l th position, ends at r th position and has w weight w may reflect local alignment score or any other measures or i is the current location j is the left end of the current location 3 5 6 1 10 7 12 4
33
Exon Chaining Algorithm
34
Reference Multiple Sequence Alignment: No specific Reference, Use Web Resources Motif Finding Problem: Chapter 4.4, Introduction to Bionformatics – by Pavel Pevzner Gene Prediction Problem: Chapter 6.11, Introduction to Bionformatics – by Pavel Pevzner
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.