1. 3.4: Transcription and Translation

2. DNA directs the activities of the cell by controlling the proteins the cell produces.
This determines what the cell becomes, what it synthesizes, and how it functions
Gene Protein occurs in 2 steps Transcription and Translation
(nucleus) (cytoplasm)

3. Gene- a section of DNA that codes for a certain protein
Genes are in specific sequences of bases in 3’s known as triplets such as GAC, TTG, or ACT

4. Transcription
The first stage of the synthesis of a protein is the production of messenger RNA (mRNA) ribonucleic acid
mRNA is an intermediate molecule that carries the coded message of DNA into the cytoplasm where the protein can be produced
Structure of RNA is similar to DNA with a few differences

5. 3.5.1: Compare the structure of RNA and DNA.

6. 3.5.1: Compare the structure of RNA and DNA.

7. Comparing DNA and RNA DNA RNA 5 carbon sugar deoxyribose
5 carbon sugar ribose
Bases- Adenine, Thymine, Guanine, Cytosine
Bases- Adenine, Guanine, Cytosine, and Uracil (in place of Thymine)
Double stranded
Single Stranded
Complementary base pairs same as DNA Uracil-Adenine

8. IB Question: Compare the structure and composition of DNA with RNA. [4]
both are polymers of nucleotides / both nucleic acids;
sugar is deoxyribose in DNA and ribose in RNA;
DNA is double stranded and RNA is single stranded;
DNA has a (double) helix;
DNA has thymine while RNA has uracil; (require full names written out)
both contain four nitrogenous bases / A, G, C, T for DNA and A, G, C, U for RNA; [4 max]

9. 3.5.2: Outline DNA transcription in terms of the formation of an RNA strand complementary to the DNA strand by RNA polymerase.

10. Transcription
Transcription is copying only one section of DNA, not the whole molecule.

11. 1.
1. DNA is unzipped by the enzyme RNA polymerase. The two strands uncoil and separate.

12. 2. Free nucleotides move into place along one of the strands

13. 3.
3. RNA polymerase assembles the free nucleotides using complementary base pairings.
They are linked and form the single strand mRNA (it’s shorter than DNA because it’s a copy of just one section (gene)

14. 4.
4. mRNA separates from the DNA and the DNA is zipped up by the RNA polymerase.

15. 5.
5. mRNA moves via the nuclear pores in the nuclear envelope to the cytoplasm for translation

16. Translation
Translation is the process by which the coded information in mRNA strands are used to construct polypeptide chains which in turn make functioning proteins.

17. Each sequence of three bases on mRNA (triplet) corresponds to a specific amino acid.
Order of triplets determines how amino acids will be assembled into polypeptide chains in the cytoplasm.
Each triplet of mRNA bases is called a codon, which codes for one amino acid.

18. Genetic code

19. 3.5.3: Describe the genetic code in terms of codons composed of triplets of bases.

20. Translation is carried out in the cytoplasm by ribosomes, molecules of another type of RNA called transfer RNA (tRNA)

21. tRNA is a single strand of RNA that is folded into a “clover leaf” shape. It’s bonded together by complementary base pairings but one area is exposed to correspond to the codons found on the mRNA molecule, this area is the anitcodon.
At the opposite end is a binding site for one amino acid which corresponds to the codon on the mRNA that matches the anitcodon of the tRNA.

22. Ribosomes have binding sites for both the mRNA and the tRNA molecules
The ribosome binds to the mRNA and then draws the specific tRNA molecule with anticodons.
Only two tRNA molecules bind to the ribosome at once. Each carries with it the amino acid specified by the anitcodon.

23. When two tRNA molecules are in place on the ribosome, a peptide bond forms between the amino acid (condensation reaction).
Once the peptide bond is formed the first tRNA molecule detaches from the amino acid and the ribosome.
The ribosome moves along the mRNA one codon to the next.
This process is repeated until a complete polypeptide is formed.
The final codon that is reached is the “stop” codon, which tells the ribosome to detach from the mRNA

24. 2. 1. 3. 4. 5.
Complementary base pairing between codon and anticodon
Another amino acid is brought in attached to its tRNA
A condensation reaction forms a peptide bond
The ribosome moves along the mRNA by one codon and a tRNA is released
Another amino acid is brought in. This continues until a ‘stop” codon is reached.

25. 3.5.4:Explain the process of translation,leading to polypeptide formation.

26. Translation

27. What will be the anticodons from the following mRNA transcript?
UAUGGAGCGCUAUCGAUCGUUAGA

28. IB Question: Explain the process of translation. [8]
messenger / mRNA attaches to ribosome (small unit);
many ribosome/polyribosomes bind to same mRNA;
carries codons / triplet of bases each coding for one amino acid;
transfer / tRNA each have specific anticodon;
triplet of bases for specific amino acid;
tRNA carries specific amino acid;
tRNA binds to ribosomes;
to corresponding triplet base / codon;
a second tRNA binds to next codon;
two amino acids bind together;
in a peptide linkage;
first tRNA detaches;
ribosome moves along mRNA;
another tRNA binds to next codon;
continues until polypeptide / protein formed to stop codon;
stop codon has no corresponding tRNA/amino acid / causes release of polypeptide; [8 max]

29. IB Question: Compare DNA transcription with translation. [4]
both require ATP;
DNA is transcribed and mRNA is translated;
transcription produces RNA and translation produces polypeptides/protein;
RNA polymerase for transcription and ribosomes for translation / ribosomes in translation
only;
transcription in the nucleus (of eukaryotes) and translation in the cytoplasm/at ER;
tRNA needed for translation but not transcription; [4 max]

30. 3.5.5 Discuss One gene one polypeptide hypothesis
In the 40’s it was thought that each gene coded for one protein.
This was later modified to state that one gene produces one polypeptide, when it was discovered that some proteins are composed of more than one polypeptide subunit and that each subunit is coded for by its own specific gene.
Hemoglobin is an example because it’s composed of two pairs of subunits and is coded for by two genes.

31. There are some exceptions to the one gene on polypeptide hypothesis.
Some DNA sequences act as regulators for the expression of other genes and are not transcribed or translated themselves.
Others code for mRNA or tRNA but not for proteins.

32. One gene may code for multiple polypeptides due to alternative splicing
mRNA strands are modified in the cytoplasm by lymphocytes by splicing together sections of mRNA in different ways to make a range of antibody proteins.