Presentation is loading. Please wait.

Presentation is loading. Please wait.

Development of Bovine Adenovirus Real Time PCR for Fecal Source Tracking Kelvin Wong, Irene Xagoraraki Abstract Bovine enteric viruses have been suggested.

Similar presentations


Presentation on theme: "Development of Bovine Adenovirus Real Time PCR for Fecal Source Tracking Kelvin Wong, Irene Xagoraraki Abstract Bovine enteric viruses have been suggested."— Presentation transcript:

1 Development of Bovine Adenovirus Real Time PCR for Fecal Source Tracking Kelvin Wong, Irene Xagoraraki Abstract Bovine enteric viruses have been suggested as an indicator for animal fecal contamination; however, no quantitative real time PCR (qPCR) assay has been reported for detecting bovine adenoviruses (BAdV). In this study, we developed a duplex FRET assay targeting BAdV serotypes1, 2 and a taqman assay targeting BAdV serotypes 4 to 8. The detection limit of the duplex FRET assay is 25 and 10 genomic equivalent copies (GEC) of BAdV-1 and 2, respectively, and the detection limit of the taqman assay is 10 GEC of BAdV-4. The specificity testing showed neither of these assay react with human adenoviruses (HuAdV) nor other animal adenoviruses/fecal samples. By using these two assays, BAdVs were successfully identified in dairy manure, and farm tile drainage water. The concentration of BAdV and coliphage in manure samples were comparable. The Sequencing results confirmed the presence of BAdV in the tested environmental samples and phylogenetic analysis indicated that BAdV 2 and 4 were the most prevalent serotypes in all the manure samples tested in this study. Conclusion The qPCR assays developed in this study could be used to detect and quantify BAdV in environmental samples. The high level of BAdV in manure indicated the potential of using BAdV as bovine fecal indicator Reference 1.Hundesa, A., C. Maluquer de Motes, S. Bofill-Mas, N. Albinana- Gimenez, and R. Girones. 2006. Appl Environ Microbiol 72:7886-93. 2.Maluquer de Motes, C., P. Clemente-Casares, A. Hundesa, M. Martin, and R. Girones. 2004. Appl. Environ. Microbiol. 70:1448- 1454. 3.Pell, A. N. 1997. J. Dairy Sci. 80:2673-2681. Results Q-402 Washington Park Table 1. Sequences of primers and probes for taqman and duplex FRET PCR assays. Figure 2. Neighbor Joining tree of group 2 BAdV identified in Meadow Farm (BAdV4-8-MF1 to BAdV4-8-MF8), Baker Farm (BAdV4-8-BF1 to BAdV4-8-BF3). Hexon gene from bovine adenoviruses, other animal adenoviruses and human adenoviruses were included in the tree. Type of Assay Serotype SpecificityName (position)Sequence (5' to 3') Amplicon Size (bps)Tm Taqman4,5,6,7 8BAV4-8F (14716-14737)CRAGGGAATAYYTGTCTGAAAATC8560.3 BAV4-8R (14775-14800)AAGGATCTCTAAATTTYTCTCCAAGA59.1 BAV4-8P (14746-14772)FAM-TTCATCWCTGCCACWCAAAGCTTTTTT-BBQ161.7 Semi-nested PCR4,5,6,7 8BAV4-8nF1 (14692-14712)TYTTYCACATTGCGGGTAGAAAT30259.2 BAV4-8nF2 (14713-14737)GCRAGGGAATAYYTGTCTGAAAATC62.1 BAV4-8nR (14990-15011)CWGTTCCTCCATAWGGYTTAAAAG60.3 Duplex FRET1BAV1F (538-557)GGAGAGGAATCTTGGTTGTC15859.9 BAV1R (670-695)ACTTGTATCAAATTGTTGTTAAGAGT59.9 BAV1Pa (617-638)CCCTGCCATGTTACGGGTCTTA-Fluorescein65.2 BAV1Pb (641-664)LC Red 640-CCGCTCCTACGAACATTGAGGGAG-Phosphate77.7 2BAV2F (18854-18877)GGTTACAAAGATAGGACATATTCG18859.6 BAV2R (19023-19041)GGCCAATTAGCTGGGTAAG60.2 BAV2Pa (18963-18990)AGCACAATAATTCTGGCTTTACTGCTTT-Fluorescein65.4 BAV2Pb (18993-19017)LC Red 705-CTAACGCTTCCCTGCCTAGAGAAGG-Phosphate67.4 Assay Type Environmental SamplesBAV1BAV2BAV4-8 Meadow Farm Manure0/139/1313/13 Baker Farm Manure3/30/33/3 Drainage2/2 Table 2. The occurrence of BAdV in manure and drainage samples. Figure 1. Comparison between the BAdV and coliphage concentration in Farm Manure Samples.


Download ppt "Development of Bovine Adenovirus Real Time PCR for Fecal Source Tracking Kelvin Wong, Irene Xagoraraki Abstract Bovine enteric viruses have been suggested."

Similar presentations


Ads by Google