1. Monitoring aquatic amphibian and reptile populations using environmental DNA Katherine M. Strickler, Caren S. Goldberg, and Alexander K. Fremier

2. Outline  What is eDNA?  When do we use it?  How do we collect and detect eDNA?  DoD projects: methods and preliminary results  Conclusions  Protocols

3. What is eDNA?

4. UV endonucleases/ exonucleases DNA in the aquatic environment DNA of ~100 bp can persist 2 – 3 weeks (Dejean et al. 2011)

5. eDNA original papers

6. Field surveyseDNA surveys 7 ponds 14% 38 ponds 77% Bullfrog detection (Dejean et al. 2012)

7. Field surveyseDNA surveys 7 ponds 14% 38 ponds 77% Bullfrog detection (Dejean et al. 2012)

8. eDNA research

9.  Marine fish (Thomsen et al. 2012)  Marine mammals (Foote et al. 2012)  New Zealand mudsnails (Goldberg et al. 2013)  Hellbenders (Olson et al. 2012, Spear et al. submitted)  Burmese python (Piaggio et al. 2013)  Brook trout, bull trout (Wilcox et al. 2013, this study)  Chinook salmon (Laramie 2013, this study)  Bd (Schmidt et al. 2013, this study)  Ranavirus (this study)

10. Advantages of eDNA  Non-destructive  Highly sensitive – higher detection probabilities  Multi-species detections (including pathogens)  Reduced need for taxon-specific field training  Reduced permitting requirements

11. When do we use eDNA?  Under what circumstances is eDNA sampling more efficient than standard field surveys? ‒ Likely will differ by species and system

12. When do we use eDNA?  Under what circumstances is eDNA sampling more efficient than standard field surveys? Effort Detection High density populations Low density populations eDNA sampling Field sampling more cost- effective eDNA sampling more cost effective

13. How do we collect eDNA?

14. Water sampling

15. How do we detect eDNA? DNA extraction (DNeasy/Qiashredder) Quantitative PCR (qPCR)

16. eDNA projects - DoD Fort Huachuca (AZ) Arizona treefrog Northern Mexican gartersnake Chiricahua leopard frog Sonora tiger salamander American bullfrog Ranavirus Bd

17. eDNA projects - DoD Eglin Air Force Base (FL) Reticulated flatwoods salamander Ornate chorus frog Yakima Training Center (WA) Bull trout, brook trout Spring and fall Chinook salmon

18.  Collect 4 replicate water filter samples in coordination with field surveys  Compare detection probabilities of eDNA vs. field surveys Developing species-specific guidance

19.  Collect environmental covariates UV exposure Conductivity Water temperature pH Area Volume  Use occupancy modeling to determine effects of covariates on detection probabilities Developing species-specific guidance

21. Arizona treefrog detection (1.0)  15 sites sampled  Detected at 4 sites  1.0 detection probability

22. Chiricahua leopard frog detection (0.65) 20 sites sampled 1 site detected by field crews missed by eDNA 2 sites detected by eDNA missed by field crews

23. ModelAICΔAICWeight Area42.9600.970 Volume51.028.060.017 Grab sample53.5210.560.005 Null54.9311.970.002 Conductivity55.3912.430.002 pH56.2013.240.001 Canopy cover56.5613.600.001 Temperature56.8813.920.001 Sampling occasion 57.9514.990.001 Chiricahua leopard frog detection probability

24. Take samples at 2 locations Take samples at 3 locations Chiricahua leopard frog detection probability

25. American bullfrog detection (0.72) 50 sites sampled 1 site detected by field crews missed by eDNA 4 sites detected by eDNA missed by field crews

26. ModelAICΔAIC Weight Temperature74.2800.531 Null78.053.770.081 Conductivity78.784.500.056 Area79.375.090.042 pH79.955.670.031 Sample volume80.025.740.030 Sampling replicate83.749.460.005 American bullfrog detection probability

27. 2 samples 3 samples 4 samples 5 samples American bullfrog detection probability

28. 23 sites sampled 3 sites detected by field crews missed by eDNA 1 site detected by eDNA missed by field crews Sonora tiger salamander detection (0.73)

29. Sonora tiger salamander detection probability ModelAICΔAICWeight Volume38.3101.0 Area57.7319.420 Null60.0721.760 Conductivity61.0022.690 Temperature61.2622.950 pH62.0723.760 Sampling occasion65.7627.450

30. Sonora tiger salamander detection probability

31. Conclusions  eDNA detection varies by species  Sampling protocols need to maximize detection Season for sampling Number of replicates Spatial distribution of replicates Volume sampled Preservation method Extraction method Analysis method  Pilot study is critical  eDNA sampling can complement field surveys

32. Protocols Field protocol Lab protocols Guidelines for eDNA sampling programs

33. Field protocol Materials Sample collection Filtration Contamination prevention

34. Lab protocol Facilities (clean room) Techniques (qPCR or next-gen sequencing) Standard practices Positive and negative controls Guidelines for selecting a laboratory to process eDNA samples

35. Preliminary guidelines Determine the most appropriate season to conduct eDNA surveys Consider spatial sampling design Consider filter type Consider preservation method Conduct a pilot study Consider how eDNA sampling can complement existing field methods Generalized guidelines for designing eDNA sampling programs

36. Thank you

37. Backup Slides

38. DNA barcoding  All individuals within a species share particular sequences Thamnophis eques (mtDNA): … GAAAGGCCCTAACCTGGTAGGACCAATA … Thamnophis cyrtopsis (mtDNA): … GAAAGGCCCCAACCTAGTAGGACCAATA … www.barcodeoflife.org Wood et al. 2011

39. Quantitative PCR (qPCR) Blue – long-toed salamander test Green – positive control More DNA Less DNA

40. qPCR negative – Idaho giant salamander Blue – long-toed salamander test Green – positive control

41. qPCR multiplex Red – Arizona treefrog Blue – Bd Green – positive control

42. eDNA qPCR Pilliod et al. 2013 Quantification as well as presence/absence

43. eDNA assay process eDNA test development: eDNA test application: Identify target species set Create and verify qPCR test Collect replicate water samples from DoD sites Run qPCR test Analyze detection data Collect DNA sequence data

44. Detection probabilities Species# sites Detection probability Arizona treefrog15 1.00 N Mexican gartersnake150.17 Chiricahua leopard frog200.65 American bullfrog500.72 Sonora tiger salamander230.73 Ranavirus230.88 Bd450.80

45. Northern Mexican gartersnake (0.17)

46. eDNA FAQs Can we use eDNA for Species X? Can we use eDNA to estimate abundance/density? What are the chances of a false positive? How much does it cost? How far downstream can eDNA be detected in streams?