1. microRNA-874 as a tumor suppressor in maxillary sinus squamous cell carcinoma based on microRNA expression signature Abstract #4143 Toyoyuki Hanazawa 1, Nijiro Nohata 1,2, Takashi Kinoshita 1,2,Naoko Kikkawa 1,Miki Fuse 1, Takeshi Chiyomaru 3, Hirofumi Yoshinoi 3, Hideki Enokida 3, Masayuki Nakagawa 3, Yoshitaka Okamoto 1 and Naohiko Seki 2 1 Department of Otorhinolaryngology / Head and Neck Surgery, Graduate School of Medicine, Chiba University, Chiba Japan 2 Department of Functional Genomics, Graduate School of Medicine, Chiba University, Chiba, Japan 3 Department of Urology, Graduate School of Medical and Dental Sciences, Kagoshima University, Kagoshima, Japan MicroRNAs (miRNAs) are an abundant class of small non-protein-coding RNAs that function as negative gene regulators. They regulate diverse biological processes, and bioinformatic data indicates that each miRNA can control hundreds of gene targets, underscoring the potential influence of miRNAs on almost every genetic pathway. Recent evidence has shown that miRNA mutations or mis-expression correlate with various human cancers and indicates that miRNAs can function as tumour suppressors and oncogenes. Overexpressed miRNAs can act as oncogenes by repressing tumor suppressor genes, whereas under-expressed miRNAs can function as tumor suppressors by negatively regulating oncogenes. miRNAs have been clearly shown to repress the expression of important cancer-related genes and might prove useful in the diagnosis and treatment of cancer. Role of microRNAs in human cancers Maxillary sinus squamous cell carcinoma (MSSCC) comprises 2-3% of all cancers of head and neck tumor and the annual incidence rate is 0.5-1.0 per 100,000 populations. Clinical symptoms of MSSCC present insidiously. Primary tumors are often diagnosed as advanced disease. The 5-years survival rate of T4 tumors is 50% around. Local recurrence is the most common cause of treatment failure and death. Maxillary sinus squamous cell carcinoma Aims of this study 1.To identify the down-regulated miRNAs based on miRNA expression signature using clinical specimens of maxillary sinus squamous cell carcinoma. 2.To elucidate the functional significance of microRNA-874 (miR-874) in maxillary sinus squamous cell carcinoma. 3.To find candidate target genes of tumor suppressive miR-874 by performing genome- wide analysis (microarray analysis and web-based program search). Take home notes 1.We revealed that miR-874 was down-regulated in tumor tissues and functioned as a tumor suppressor based on miRNA expression signature of clinical specimens of maxillary sinus squamous cell carcinoma. 2.Genome-wide expression analysis using miR-874 transfectants revealed that PPP1CA, PAAF1 and TGOLN2 were overexpressed in tumor tissues and were inversely correlated with miR-874 expression in clinical samples. 3. miR-874 directly regulated PPP1CA expression in both mRNA and protein levels. 4.Knockdown of PPP1CA by siRNA inhibited cell proliferation in IMC-3 cells. 5.The PP1a catalytic subunit can form complexes with many regulatory subunits, which regulate various cellular activities such as cell cycle, apoptosis, and signal transduction. 1. Characteristics of twenty patients with maxillary sinus squamous cell carcinoma miRNA Accession No.Chromosome Locus Fold change Normalized ratio P-Value NormalTumor miR-874MIMAT00049115q31.20.0113.05E-043.36E-060.0463 miR-133aMIMAT000042718q11.2, 20q13.330.0171.89E-023.14E-040.0033 miR-375MIMAT00007282q350.0353.95E-021.36E-030.0161 miR-204MIMAT00002659q21.120.0453.26E-021.47E-030.0055 miR-1MIMAT000041618q11.2, 20q13.330.0541.88E-031.02E-040.0240 No.AgeGenderDifferentiationTNMStage 168MaleWell4b00IVB 277MalePoor300III 376MaleModerate300III 461MaleWell300III 554MalePoor300III 665FemalePoor4b00IVB 765MaleModerate4a00IVA 864MalePoor4b00IVB 974MaleWell4a00IVA 1071MaleModerate310III 2. Top five down-regulated miRNAs from TaqMan Low Density Array (n=5) 3. miR-874 expression levels and tumor suppressive function in IMC-3 cells AACR 103 rd ANNUAL MEETING, Tuesday April 3, 2012, 1:00 PM – 5:00 PM NormalTumor P = 0.0307 0 0.020 0.015 0.010 0.005 miR-874 expression (Normalized to RNU48 ) *:P< 0.05 No.AgeGenderDifferentiationTNMStage 1164MaleModerate4a00IVA 1280MaleModerate4a00IVA 1366FemalePoor4a2c0IVA 1467MaleModerate4a00IVA 1560MalePoor4a00IVA 1666FemaleModerate4a00IVA 1785MalePoor4a00IVA 1869MaleWell4a00IVA 1957MalePoor4a00IVA 2069MalePoor4a2b0IVA 0 20 40 60 80 100 120 controlmiR-874 Proliferation (% of control) * EntrezGene ID GeneNameGene Symbol Log2 rario miR-874 target 1373carbamoyl-phosphate synthetase 1, mitochondrial CPS1-1.852 3939lactate dehydrogenase ALDHA-1.75- 1915eukaryotic translation elongation factor 1 alpha 1 EEF1A1-1.45- 5499protein phosphatase 1, catalytic subunit, alpha isozyme PPP1CA-1.251 5660prosaposinPSAP-1.23- 80227proteasomal ATPase- associated factor 1 PAAF1-1.221 567beta-2-microglobulinB2M-1.21- 303annexin A2 pseudogene 1ANXA2P1-1.18- 5223phosphoglycerate mutase 1 (brain) PGAM1-1.15- 1303collagen, type XII, alpha 1COL12A1-1.091 3486insulin-like growth factor binding protein 3 IGFBP3-1.08- 2778GNAS complex locusGNAS-1.08- 55536cell division cycle associated 7-like CDCA7L-1.06- 8667eukaryotic translation initiation factor 3, subunit H EIF3H-1.051 10916melanoma antigen family D, 2MAGED2-1.05- 10618trans-golgi network protein 2 TGOLN2-1.032 4077neighbor of BRCA1 gene 1NBR1-1.021 343477heat shock protein 90kDa beta (Grp94), member 3 (pseudogene) HSP90B3P- Overexpressed miRNAs as oncogenes Underexpressed miRNAs as tumor suppressors rs=-0.465 P=0.002 rs=-0.477 P=0.002 rs=-0.464 P=0.003 0 1.0 2.0 3.0 4.0 5.0 6.0 P=0.0154 NormalTumor Normalized to GUSB PPP1CA mRNA expression 0 0.05 0.10 0.15 0.20 0.25 P=0.0298 NormalTumor PAAF1 mRNA expression Normalized to GUSB P=0.0312 0 0.5 1.0 1.5 2.0 2.5 3.0 NormalTumor TGOLN2 mRNA expression Normalized to GUSB 4. Down-regulated genes by miR-874 in IMC-3 cells 5. Three candidate genes were overexpressed in tumor and were inversely correlated with miR-874 expression PPP1CA mRNA expression (% of miR-control) 0 20 * 40 60 80 100 120 PP1α normalized to β-Actin 0 20 40 60 80 100 120 PP1α β-Actin 0 si-control si-PPP1CA_1 si-PPP1CA_2 Cell viability (% of si-control) 20 *** 40 60 80 100 120 *** (%) 1 2 3 4 5 0 0hr24hr48hr72hr Cell number (x10 4 ) miR-874 miR-control * 237-243 5‘...GCCGAGGCUGCAGCUCAGGGCAA... ||||||| 3’ AGCCAGGGAGCCCGGUCCCGUC 5‘...GCCGAGGCUGCAGCU-------A... ||||||| 3’ AGCCAGGGAGCCCGGUCCCGUC Position 237-243 deletion Position 237-243 PPP1CA (NM_001008709) 3’UTR length:353 miR-874 target sites 100300 200 miR-control miR-874 *:P< 0.05 Luminescence (normalized) 237-243 wild type 0 0.2 0.4 0.6 0.8 1.0 1.2 * 237-243 deletion *:P< 0.05 * 1 2 3 4 0 0hr24hr48hr72hr Cell number (x10 4 ) si-PPP1CA_1 si-control si-PPP1CA_2 * *:P<0.0018, **:P<0.0005 ***:P<0.0001 6. miR-874 directly regulated PPP1CA expression in both mRNA and protein levels 7. si-PPP1CA inhibited cell growth in IMC-3 cells