1. DNADNA

2.  1928  Brittish Biologist Frederick Griffith  Researches bacteria and mice

7. 1. Something made the harmless bacteria lethal 2. All descendants of bacteria were lethal 3. Something must have been transferred from the dead lethal bacteria to the living non-lethal bacteria 4. WHAT WAS THE TRANSFORMING FACTOR????? HMMMMMMMM????????

8.  1944  American Biologist Oswald Avery  Thought maybe proteins were the transforming factor  Treated Griffith’s mixture w/ protein destroying enzymes  Mice still died  Thought maybe DNA was the transforming factor  Treated Griffith’s mixture w/ DNA destroying enzyme  Mice lived Avery concluded DNA was the transforming factor.

9.  1952  Alfred Hershey & Martha Chase  Did tests using viruses  VIRUS  a nucleic acid surrounded by a protein coat  Not living  Not made of cells  Can only reproduce by infecting living cells

10.  Bacteriophage : a virus that only infects bacteria  Hershey & Chase knew DNA or proteins were the hereditary material  Which one??  HMMMMM???

12.  DNA was what caused the bacteria to make new phages  Not proteins DNA is the hereditary material

14.  Double Helix  Two twisted strands with complementary base pairs  Watson & Crick (1953)

15.  The heritable genetic information of an organism—stores, copies, and transmits genetic information  YOUR instruction manual  Deoxyribonucleic acid  A type of nucleic acid  A poly mer  Made of nucleotides (monomers)

20.  The building blocks or subunits (monomers) of nucleic acids  So what are nucleic acids?  Polymers (large, repeating molecules) made of nucleotides  4 types of nucleotides make up DNA

21.  Each nucleotide is made up of: 1. Sugar 2. Phosphate 3. Nitrogenous Base (A, C, T, or G)

22.  The four nucleotides that make up DNA differ only by their bases:  Adenine  Cytosine  Guanine  Thymine

23.  Nucleotides are joined together by covalent bonds  Connect sugar—phosphate—sugar—phosphate  Sugar-phosphate backbone

25.  Adenine always pairs/bonds with Thymine  2 Hydrogen bonds  Guanine always pairs/bonds with Cytosine  3 Hydrogen bonds So which is easier to break? A=T G = C

27.  AAGCTACGGTTCACATGATCAACTTGA  TTCGATGCCAAGTGTACTAGTTGAACT  GATACA  CTATGT  AGCATTAGGAATTACAG  TCGTAATCCTTAATGTC

30.  %A=%T  %G=%C  Practice: 30%T=  A  G  C

33. Small, distinct sections of DNA are called genes. These genes control specific traits. A genome is all of the different genes in one organism (a complete set of genetic material). Your genetic code is your sequence of nucleotides (ex. AATTCGCTCGG), which in turn, determine genes, create genes and ultimately make you who you are. The environment in which you live also

34. The environment in which you live also influences gene expression. For example, proper nutrition can make you taller and sun exposure can make you tan or cause skin cancer. Triggers in the environment (like chemicals) can turn genes on or off.