2. SUMMARY Cypress canker –Infectious propagules called conidia are multicelled, genetically identical to parent, and need a wound to infect –Genetic studies reveal one clone in Europe and many in California –Disease caused by exotic pathogen in Europe and by off site planting and exotic host in California

3. Conidia of Seiridium cardinale observed by optical microscope and SEM

4. SUMMARY Heterobasidion –Primary infection caused by airborne genetically distinct basidiospores –Secondary infection of adjacent trees caused by direct root to root contact –Host specificity of H.irregulare vs. H. occidentale –Stumps main infection courts for H. irregulare on pine/juniper, wounds for true fir/sequoia –Environmental changes increase abundance of this root and bole pathogen Armillaria (Honey mushroom) –Mostly secondary infection thanks to rhizomorphs, largest organism in the world

5. True firs Pines Each spore is a genetically different individual: In pines we found the same genetic individual in stumps and adjacent trees indicating direct contagion between the two In true firs and true firs/sequoias we find same individual in adjacent standing trees indicating infection not linked to stumps but to wounds on standing trees

6. “Emergent diseases”: 3: exotic pathogens 99% of times human responsible for their introduction99% of times human responsible for their introduction

7. Like the conquistadores brought diseases that were lethal to those who had never been exposed to them, so do exotic diseases cause true devastation in plant communities because of lack of coevolution between hosts and microbes

8. California invaded: 1849 A.D. New hybrid root pathogen 1990s White pine blister rust 1930s Port Orford Cedar Root Disease 1950s Pitch canker disease 1980s Dutch Elm Disease 1960s Sudden Oak Death 1990s Oak root canker 2000 Manzanita/madrone die-back Canker-stain of Sycamores 1980’s

9. How can people transport pathogens By transporting plants and plant parts –Crops, and seeds –Raw food –Ornamental plants Untreated lumber Soil Insects vectoring fungi Military activity

10. The Irish Potato Famine From 1845 to 1850 Phytophthora infestans Resulted in the death of 750,000 Emigration of over 2 million, mainly to the United States.

12. Girdling aerial ‘cankers’ removed from roots

13. Big Sur 2006 K. Frangioso

14. P. ramorum present P. ramorum absent Wickland et al., unpublished

15. P. ramorum growing in a Petri dish

16. Organism new to science Origin unknown Biology unknown Symptoms caused unknown Immediately though highly regulated

17. Stem canker Leaf necrosis Rhododendron: In EU mostly a nursery issue, but also present in nurseries in US and Canada

18. Phytophthora ramorum Sporangia Chlamydospores

19. Is it exotic? Our studies have indicated that California population is extremely simplified, basically two strains reproducing clonally as expected of an introduced organism Many hosts appear to have no resistance at all Limited geographic distribution

20. Where does it come from? It is unknown where pathogen originally comes from, but previous studies have shown that California forest population is derived from a relatively genetically diversified US nursery population, indicating ornamental nurseries were the most likely avenue for pathogen introduction

21. Let’s look at its genetic structure Need a number of independent and neutral DNA markers Used AFLP, a technique that scans the entire nuclear genome Are our isolates the same as the European ones? Is the genetic structure suggestive of an introduced or native species?

22. US forest isolates clearly distinct from EU nursery isolates, also have different mating type Isolates from nurseries in WA, OR, & BC both of the US and EU types Potential for XXX sex and recombination in US nurseries US forest population is genetically very homogeneous, trademark of an introduced species

23. The entire genome was sequenced in less than 3 years since discovery of organism * 12 SSR loci (di- and tri- repeats identified) * Loci selected to be polymorphic both between and within continental populations * 500+ representative isolates analyzed CCGAAATCGGACCTTGAGTGCGG AGAGAGAGAGAGA CTGTACGAGCCCGAGTCTCGCAT

24. Mating Type A1 A2 Growth Rate Fast Slow Fast

25. Terminology Genotype Lineage Population

26. Results of 1st microsatellite study There actually three distinct (genotypically and phenotypically) lineages of P. ramorum Very low diversity in US forests (microsats cannot discriminate among individuals, clonality confirmed), only one lineage Several genotypes but only one lineage in EU nurseries Three lineages in US nurseries

27. Was the pathogen first in US forests or in US nurseries? Slide 12

28. Was the pathogen first in US forests or in US nurseries? Slide 12 nurserie s forests

29. Where was it introduced? First reports mid 90’s Pathogen identified in 2000 By then, the pathogen was widespread CLUES: severity of symptoms and anedoctal stories Positive isolation P. ramorum

30. We found same genotypes in nurseries and forests proving origin of wild outbreak

31. nurseries Introduction phase 1- Escape of pathogen from Infected nursery plants at two locations: Mount Tamalpais (Marin County), and Scott’s Valley (Santa Cruz County) 2- Nurseries and two sites have identical strain composition, but distance between sites is impossible for natural spread of organism

32. What favors invasion of exotic fungi ? –Density of host increases severity of disease –Corridors linking natural habitats –Synchronicity between host susceptibility and pathogen life cycle –Ecological and environmental conditions

33. Bay/Oak association Bleeding canker Canker margin in phloem Bay Coast Live Oak (no sporulation) Sporangia

35. Mantel test among all individuals. [Moran ’ s I vs ln (geographic distance)] Site ID Correlation coeff. (r) P-value (1000,000 perm) ALL -0.2153<0.000001