1. Module 4 – Mutational analysis of the lac operon Week 1

2. Overview Week 1: Bioinformatics to identify mutations in DNA and analyze restriction enzyme maps Week 2: Confirm mutations using RE digestion and agarose gel electrophoresis Week 3: Oral presentations of the lac operon mutants we discover.

3. LacZ coding region CAP Start Oper. -35-10 Structure of the E. coli lac operon Operons are regulatory units in bacterial genomes Promoter region (above) controls when transcription of mRNA from DNA template occurs Lac operon controls expression of three genes needed for metabolizing lactose – LacZ, LacY and LacA genes

4. Nucleotide sequence in promoter region of lac operon CAP = cAMP binding protein (CAP) recognition site -35 and -10 are transcription factor binding sites Operator/LacI = Operator region when the LacI inhibitor protein binds Trans. Start = place where RNA polymerase binds to start transcription ATG codon is the starting methionine of the coding region for β-Gal CAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGG CTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGA GCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATT CAP binding site Operator/LacI…-10 site-35 site …binding siteTranscription startMethionine start LacZ coding region CAP Start Oper. -35-10

5. Glu Lac RNA polymerase binds and transcribes DNA CAP -35 -10 Oper. Start Coding region Regulation of the lac operon by sugar Absence of glucose and presence of lactose required for activation of transcription of the lac operon.

6. Plasmids are autonomous, self-replicating DNA molecules Plasmids are closed, circular, double-stranded DNA Small size (<10 kb) allows efficient transfer into cell Autonomously replicate (separate from chromosomal DNA of host) Selectable marker (e.g., antibiotic resistance gene, ampicillin) discriminates plasmid-containing cells Multiple cloning site (MCS) allows insertion of foreign DNA using restriction enzymes

7. Using plasmids as carriers of genetic material Example shown is genomic DNA Insert DNA fragments into cloning vector Once created, plasmids can be purified and analyzed for genetics mutations

8. Inserting the lac operon into the plasmid allows us to look for mutations A set of plasmids is available in which the wild-type lac operon and mutant lac operons have been cloned into a plasmid Increased size of plasmid due to insert Easy to purify, sequence the DNA, and analyze using restriction enzymes

9. DNA sequences for lac operon will be provided to you pLac/WT is the DNA sequence for the lac operon without mutations Mutants m1 through m7 will be compared with the WT for genetic variations Types of mutations you might find: – Substitutions – Insertions (frameshift?) – Deletions (frameshift?) – Truncation

10. Compare DNA sequences using a program that performs alignment Biology Workbench 3.2 will be used Enter sequences of WT and your mutant Using ALIGN program to perform alignment

11. Alignment results A portion of the alignment results shown below Length of sequences reported Identify number of identities/mis-matches

12. Restriction endonucleases: molecular scissors Enzymes that cleave double-stranded DNA at specific restriction site on DNA Recognize very specific base sequences – Usually palindromic sequences Two strands are identical when read in same polarity – Typically 4-8 nucleotides in length – Cleavage of bond on each strand often leads to “sticky ends” with nucleotide overhang Blunt ends occur when restriction enzyme does not leave overhang

13. Many restriction enzymes create “sticky ends” NdeI: 5’ CATATG 3’ GTATAC  BamHI: 5’ GGATCC 3’ CCTAGG

14. Restriction map Use the full-length sequence of lac operon inserted into plasmid backbone Analyze all possible RE cutting sites with program TACG Carry out analysis for both WT and mutant. Look for differences in the RE cutting pattern that can be used as a diagnostic

15. Results from TACG program for pLac/WT Selected Sequence(s) pLac/WT insert Enzymes that DO NOT MAP to this sequence Enzymes that DO NOT MAP to this sequence Total Number of Hits per Enzyme Cut Sites by Enzyme Pseudo-Gel Map of Digestions Fragment Sites by Enzyme Linear Map of Sequence

16. Enzymes that DO NOT MAP to this sequence: AarI AclI AflII AgeI AhdI AjuI AloI ArsI AscI AsiSI AvrII BarI BbeI BbvCI BglII BmgBI BmtI BplI BpuEI BsaI BseRI BsmI BspEI BspHI BsrDI BsrGI BstAPI BstEII CspCI EcoNI FalI FseI FspAI KasI KflI MfeI MreI MscI NaeI NarI NcoI NgoMIV NheI NruI NsiI PacI PasI PmeI PmlI PpiI PshAI PsiI PsrI RsrII SapI SbfI ScaI SexAI SfiI SfoI SgrAI SgrDI SnaBI SphI SrfI StuI SwaI Tth111I XbaI XmnI

17. Cut Sites by Enzyme (examples) AatII G_ACGT'C (0 Err) - 1 Cut(s) 1011 AbsI CC'TCGA_GG (0 Err) - 1 Cut(s) 286 Acc65I G'GTAC_C (0 Err) - 2 Cut(s) 271 568 AcuI CTGAAGnnnnnnnnnnnnnn_nn' (0 Err) - 1 Cut(s) 1122 AfeI AGC'GCT (0 Err) - 1 Cut(s) 2223 AleI CACnn'nnGTG (0 Err) - 4 Cut(s) 1728 2677 3223 3458

18. Determine size of fragments produced 0 cuts will leave plasmid DNA supercoiled 1 cut will linearize DNA; need to know total bp to predict its size 2 cuts will first linearize and then generate two different fragment Acc65I - 2 Cut(s) at position 271 and 568 – 568-271 = 297 bp – Second piece is 5911 – 297 = 5614 bp – Separating RE digest shows two bands at these sizes

19. Comparing WT and mutant RE maps can reveal differences in predicted fragment size Look for appearance or disappearance of a restriction site Look for a large shift in the size of a fragment of the mutant versus WT DNA

20. Homework Email or give to Krist by next Tuesday Exercise #1 – Copy of your alignment – Answers to three questions Exercise #2 – Copy of your restriction analysis output – Answers to two questions Next time: use the restriction analysis to cut the DNA and run gels