1. The CFAR Biohazard Animal Core Director: John Chan, MD Co-Director: Larry Herbst, PhD Staff: Jiayong Xu, BA Location:AECOM, Chanin Bldg AECOM, Price Bldg

2. The Goal of the Biohazard Animal Core To provide a biosafety level 3 (BSL 3) containment facility for studies involving in vivo modeling of infection with HIV-1 and AIDS- associated pathogens using various murine experimental models

3. Implementation of the Goals of the Biohazard Animal Core To provide a safe laboratory environment for the performance of experiments involving biohazardous pathogens that require a BSL 3 containment facility. To provide reagents, including specific strains of pathogens, training, and technical assistance to facilitate research using murine infectious disease models involving HIV-1 and AIDS- associated pathogens such as Mycobacterium tuberculosis and Cryptococcus neoformans. To provide comprehensive services to researchers not familiar with studies involving infection of mouse with biohazardous pathogens, which are designed to investigate pathogen-host interaction, pathogen-pathogen interaction, drug discovery, as well as mechanisms involved in pathogenesis and host defense. To provide assistance in the study design and data interpretation of in vivo studies involving the use of murine models of infection. To provide support in breeding, genotyping, and maintenance of specific transgenic and gene- knockout mouse strains.

4. The Chanin lab (~1,500 sq ft): 2,000 mice The Price lab (~2,000 sq ft): 2,200 mice Capacity of the Animal Core

5. Infection by Aerogenic Challenge We have extensive experience in infecting mice with Mycobacterium tuberculosis via aerosols using the "Wisconsin" chamber or the In-Tox "nose-only" aerosolization apparatus and will optimize conditions for the aerosolization of other pathogens

6. The Chanin Aerosolization Machine

7. The Intox Nose-Only Aerosolization Apparatus

8. Tissue Bacterial Burden Time Adaptive Immunity Initiation of Immunosuppressive Therapy Chronic Phase Reactivation Phase Low-Dose Reactivation Model of Tuberculosis

9. Tissue Bacterial Burden Time Adaptive Immunity Initiation of Anti-TB Therapy Apparent Sterile State Reactivation Phase The Cornell Model of Reactivation Tuberculosis

10. Lung: 3 months Post-Mtb Infection (Paraffin-embedded Tissues Analysis of Tissues of Pathogen-infected Animals Lungs: 6 months Post-Mtb Infection (Frozen Sections) Liver: 6 months Post-Mtb Infection (Laser Capture Microdissection)

11. Immunofluorescence Staining of Tuberculous Tissues

12. Immunophenotyping of Cells from Infected Tissues

13. The SCID-hu Mouse Model The thy/liv-SCID-hu mice are generated by the core and can be infected with various titered R5, X4, and X4R5 primary isolates of HIV obtained from the BSL3/Virology Core to examine anti-HIV effects of novel therapeutics developed by CFAR investigators

14. Thy-liv-SCID-hu mice: An in vivo Model for Evaluating Anti-HIV-1 Therapy Constructed by implanting human fetal thymus and liver under the kidney capsule of SCID mice. The peripheral blood and lymphoid tissues of the mice are populated with > 5% human T cells and monocytes. After i.p. inoculation of HIV-1, human cells in the peritoneum become infected, migrate to lymph nodes and traffic to and infect the human thymic implant.

15. Mice with Infection of Thymic Implants of thy/liv-SCID-hu HIV-1 Inject HIV-1 into thy/liv SCID-hu mouse Limiting Co- culture of implant to analyze for HIV infection

16. Specialty Mouse Strains Provide a number of mouse strains including SCID, Rag-/-, Rag2 -/-  c -/-, and the NOD (nonobese-diabetic)/SCID/IL2R  null mouse models. Cryopreservation of mouse strains

17. A Novel Transgenic Mouse Model Construct #1: human CD4-P2A-CCR5 E: mCD4 Enhancer P: mCD4 Promotor 2 4 3 SalI hCD4hCCR5P2A 1 Primer 1: ACGC GTCGACGCCACCATGAACCGGGGAGTCCCTTTTAG Primer 2: CTGCTTGCTTTAACAGAGAGAAGTTCGTGGC TCCGGAACCAATGGGGCTACATGTCTTC Primer 3: GCCACGAACTTCTCTCTGTTAAAGCAAGCAGGAGACGTGGAAGAAAACCCCGGTCCC atggattatcaagtgtcaag Primer 4: TTCCGCGGCCGCTATGGCCGAC GTCGACTCACAAGCCCACAGATATTTC SalICD4 P2A CD4 P2ACCR5 SalI Construct # 2: human Cyclin T1

18. 10 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5 00 0.9499.1 F1 progeny transgenic mouse 3.35 13.7 10 1 2 3 4 5 1 2 3 4 5 10.3 1.16 4.3884.1 10 1 2 3 4 5 1 2 3 4 5 10.6 0.93 2.6885.7 10 1 2 3 4 5 1 2 3 4 5 53%30% 4.7911.7 12.90.86 4.381.9 10 1 2 3 4 5 1 2 3 4 5 72%10% 1.8215.9 10 1 2 3 4 5 1 2 3 4 5 3.650 0.7395.6 Control mouse No. 724 No. 726 No. 730 Mouse CD4 cells Mouse CD8 cells Human CCR5 Human CD4 Selective expression of hCD4 and CCR5 by mouse CD4 cells. PBMCs were isolated from a control mouse and three F1 progeny of founder mouse No.479. Expression of hCD4 and CCR5 by the mouse CD4+ cells and CD8+ cells was analyzed by two-color flow cytometry. The percentage of positive cells in each quadrant is indicated. A Novel Transgenic HIV Mouse Model 51% 32%

19. The Gnotobiotic Facility

20. In vivo Imaging: the IVIS Spectrum The IVIS

21. IVIS: Tracking Malaria Infection CQ: Chloroquine; PQ: Primaquine; Ato: Atovaquone

22. Behavioral Study of NeuroAIDS

23. Other Animal Procedures post-mortem dissection for the procurement of infected organs retro-orbital bleed delivery of pharmacological or biological agents by various routes (oral, subcutaneous, intramuscular, intravenous, respiratory, intraperitoneal, retro-orbital and intracranial) Provide biohazard barrier housing and husbandry for mice infected with HIV and various AIDS-related pathogens Provide training for experimental techniques involved in conducting animal BSL3 experiments with various pathogens

24. Accomplishments of the Animal Core Acquisition of the in vitro imaging system: IVIS Spectrum The NeuroAIDS model, including the establishment of the radial water maze for behavorial study (addition of 500 sq ft) Establishment of a novel HIV mouse model: mice transgenic for expression of human CD4, CCR5 and Cyclin T1 that display successful in vitro and in vivo HIV infection. Novel mouse strains: Rag2 -/-  c -/-, and the NOD/SCID/IL2R  null mouse models Additional 1,500 sq ft BSL3 facility (2,200 mice) New programs: interactions between HIV and M. tuberculosis, Malaria, and Herpes Virus; in vivo analysis of neuroAIDS in mice Publication (2008-2011): 36 Users: the Core supports the research of 25 investigators (2011 progress report; 21 major users); first progress report of 2004 listed 8 investigators as major users

25. Acknowledgements CFAR Cores and Staff: Virology, Developmental, Flow Cytometry, Immunology/Pathology, Clinical Cores. CFAR investigators and collaborators Albert Einstein College of Medicine/Montefiore Medical Center