1. DNA Technology Genetic Engineering

2. DNA Technology DNA Technology – science involved in the ability to manipulate genes/DNA Purpose: ◦Cure disease (Cystic Fibrosis) ◦Treat genetic disorders (Hemophilia, diabetes) ◦Improve food crops (better tasting, longer shelf life, fungus resistance…) ◦Improve human life in general ◦Helps us ID genes for traits

3. I. How could you get a desired trait without directly manipulating the organisms’ DNA? A. Selective Breeding - choosing organisms with desired traits to produce the next generation Breeding the winners of a horse race (Smarty Jones) Taking the seeds from the Great Pumpkin

4. B. Hybridization Crossing organisms with different traits to produce a hardier product Ex. A mule is a cross of a horse and a donkey – Sturdy and surefooted Hybrid corn – tastes good and is more resistant to disease.

5. C. Inbreeding Maintaining the present genes by breeding only within the population Ex. Pedigree animals Risk with dipping into the same gene pool and recessive traits showing up that may be lethal or harmful.

6. D. Inducing mutations By using known mutagens, attempt to force mutations to occur Radiation & Chemicals Not a sure bet nor do you know what you are going to get Polyploidy (3N or 4N) plants have resulted from this – larger & hardier

7. II. Manipulating Genes by altering an organisms DNA DNA Technology Purpose Cure Diseases Treat Genetic Disorder Improve Food Crop Improve Human Life (reproduce desired traits)

8. III. Practical Uses of DNA Technology (positive) Pharmacutical Products Genetically engineered vaccine Increasing Agricultural Yields (negative) Allergies GMO (genetically Modified Organisms) Supperweeds

9. Cloning Growing a population of genetically identical cells from a single cell Let’s discuss the positives and negatives of m cloning….. Let’s do a little research first…… Lab Bio: Read Pros and Cons of Cloning Honors Bio: Read The Real Face of Cloning

10. DNA Technology: ex: Gene Therapy Treatment of a genetic disorder (like cystic fibrous) by correcting a defective gene that causes a deficiency of an enzyme. Nasal spray that carries normal enzyme gene. Body makes enzyme and patient breathes normally. Regular treatments necessary Has not been proven to be successful in the long term

11. How do we copy a piece of DNA….. The Tools: DNA Extraction – Chemical procedure (we’ll do this) Restriction enzymes – molecular scissors that cut DNA at specific nucleotide sequences Restriction enzymes Gel Electrophoresis – method to analyze fragments of DNA cut by restriction enzymes through a gel made of agarose (molecular sieve) Gel Electrophoresis DNA Ligase – molecular glue that puts pieces of DNA together Polymerase Chain Reaction (PCR)- molecular copy machine. Makes millions of copies of DNA/hr

12. Let’s suppose that you are a diabetic and can not make your own insulin. What are you to do? Inject insulin of course but from what source? Old method was to use sheep insulin. Costly and labor intensive New method: Let bacteria with a human insulin producing gene make it for you

13. The Method: Transformation of a bacterium to produce human insulin 1.Extract the insulin producing gene from a healthy human 2. Using a restriction enzyme, cut the insulin producing gene out of a the DNA

14. What are restriction enzymes? Bacterial enzymes – used to cut bacteriophage DNA (viruses that invade bacteria). Different bacterial strains express different restriction enzymes Restriction enzymes recognize a specific short nucleotide sequence For example, Eco RI recognizes the sequence:  5’ - G A A T T C - 3’  3’ - C T T A A G - 5’  Pandindrones same base pairing forward and backwards

16. Let’s try some cutting: Using this piece of DNA, cut it with Eco RI  G/AATTC GACCGAATTCAGTTAATTCGAATTC CTGGCTTAAGTCAATTAAGCTTAAG GACCG/AATTCAGTTAATTCG/AATTC CTGGCTTAA/GTCAATTAAGCTTAA/G

17. What results is: GACCG AATTCAGTTAATTCG AATTC CTGGCTTAA GTCAATTAAGCTTAA G Sticky end Sticky end - tails of DNA – easily bind to other DNA strands

18. Blunt & Sticky ends Sticky ends – Creates an overhang. EcoRI Blunts- Enzymes that cut at precisely opposite sites without overhangs. SmaI is an example of an enzyme that generates blunt ends

19. Cloning Vectors Cloning vector is a carrier that is used to clone a gene and transfer it from one organism to another. Many bacteria contain a cloning vector called a PLASMID. PLASMID  is a ring of DNA found in a bacterium in addition to its main chromosome

20. 3. Cut cloning vector: Use bacterial plasmids ◦Plasmids will be cut with the same restriction enzyme used to cut the desired gene

21. 4. Ligation - Donor gene (desired gene) is then spliced or annealed into the plasmid using DNA ligase as the glue. Recombinant DNA - DNA with new piece of genetic information on it 5. Plasmid is then returned to bacterium and reproduces with donor gene in it. Transgenic organism – organism with foreign DNA incorporated in its genome (genes) 6. Bacterium reproduces and starts producing human insulin gene which we harvest from them.

22. Recombinant DNA Donor Gene

24. Expression of Cloned Genes Sometimes PROMOTERS must also be transferred so the genes will be turned on. Genes are often turned off until the proteins they code for are needed.