2. AP Biology 2007-2008 From Gene to Protein How Genes Work

3. AP Biology What do genes code for? proteinscellsbodies How does DNA code for cells & bodies?  how are cells and bodies made from the instructions in DNA DNA

4. AP Biology The “Central Dogma” Flow of genetic information in a cell  How do we move information from DNA to proteins? transcription translation replication protein RNA DNAtrait

5. AP Biology mRNA From gene to protein DNA transcription nucleuscytoplasm a a a a a a a a a aa ribosome protein translation trait

6. AP Biology Transcription from DNA language to RNA language

7. AP Biology RNA Review… ribose sugar N-bases  uracil instead of thymine  U : A  C : G single stranded Many types of RNA  mRNA, tRNA, rRNA, siRNA… RNADNA transcription

8. AP Biology Transcription Making mRNA  transcribed DNA strand = template/coding strand  enzyme RNA polymerase RNA polymerase is versatile (it slices, it dices!)  Unwinds, unzips, adds in complementary RNA bp’s template strand rewinding mRNA RNA polymerase unwinding DNA C C C C C C C C CC C G G G G GG GG G G G A A A AA A A A A A A A A T T T T T T T T T T T T UU 5 3 5 3 3 5 build RNA 5  3

9. AP Biology Initiation: Where to begin? Promoter region  = binding site before beginning of gene  “TATA box” binding site indicates location  “Upstream” of gene to transcribe/copy = binding site for RNA polymerase

10. AP Biology Elongation Match RNA bases to DNA bases on one of the DNA strands 5’  3’ direction U AGGGGGGTTACACTTTTTCCCCAA U U U U U G G A A A CC RNA polymerase C C C C C G G G G A A A A A 5'3'

11. AP Biology Termination Eventually…  RNA transcript is released  RNA polymerase detaches (complete mechanism still not fully known)

12. AP Biology Eukaryotic genes have junk! Eukaryotic genes are not continuous  exons = the real gene expressed / coding DNA  introns = the junk inbetween sequence eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence introns come out!

13. AP Biology mRNA splicing eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence primary mRNA transcript mature mRNA transcript pre-mRNA spliced mRNA = “Post-transcriptional processing ”  eukaryotic mRNA needs work after transcription  primary transcript = pre-mRNA  mRNA splicing edit out introns  make mature mRNA transcript ~10,000 bases ~1,000 bases

14. AP Biology Splicing must be accurate No room for mistakes!  a single base added or lost throws off the reading frame AUG|CGG|UCC|GAU|AAG|GGC|CAU AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU Met|Arg|Ser|Asp|Lys|Gly|His Met|Arg|Val|Arg|STOP|

15. AP Biology RNA splicing enzymes snRNPs exon intron snRNA 5'3' spliceosome exon excised intron 5' 3' lariat exon mature mRNA 5'

16. AP Biology Alternative splicing Alternative mRNAs produced from same gene  when is an intron not an intron…  different segments treated as exons

17. AP Biology A A A A A 3' poly-A tail mRNA 5' 5' cap 3' G P P P 50-250 A’s More post-transcriptional processing Need to protect mRNA on its trip from nucleus to cytoplasm  Enzymes in cytoplasm attack mRNA protect the ends of the molecule from degrading add 5 GTP cap add poly-A tail  longer tail = mRNA lasts longer: produces more protein

18. AP Biology mRNA From gene to protein DNA transcription nucleuscytoplasm a a a a a a a a a aa ribosome protein translation trait