1. Unit 1 – Diversity of Living Things The international year of Biodiversity 2010 http://www.youtube.com/watch?v=V1V YmpTikgw International day of Biodiversity - May 22 2014

2. The Axolotl

4. What is Biodiversity? Biodiversity= the number and the variety of species on Earth Overall ~ 30-100 million species exist but only 1.75 millions species categorized so far

5. Edward O. Wilson Coined the term Biodiversity in 1988 Discover Life IDnature database http://www.discoverlife.org/nh/id/

6. How is a “species” defined? 2 ways: (i)Biological species concept Species= a group of organisms that interbreed and produce fertile offspring (ii)Morphological species concept Species defined on a set of shared physical characteristics

7. Advantages and disadvantages to the following definitions of a species: A) Biological species concept AdvantagesDisadvantages Widely used by scientists Not applicable to different plants species that can hybridize under natural conditions or If species reproduce asexually

8. Advantages and disadvantages to the following definitions of a species: b) Morphological species concept AdvantagesDisadvantages Simple to use Incorporates plants and organisms that reproduce asexually Almost all pop’n are made up of non-identical individuals  doesn’t mean that are not from the same species

9. Nature's Services to Humans –Clean water, clean air, soil for agriculture, the pollinating effect of many insects etc. Economic Reasons -Lumber, fishery catches, agriculture, livestock, recreation Medicine Aesthetic and Intrinsic Value Why is studying biodiversity important?

10. Taxonomy Taxonomy is the identification, classification, and naming of species.

11. If you were a taxonomist in charge of creating a universal system of classifying organisms. What are the challenges in classifying Earth’s millions of species? 1. What language would you use? 2. What criteria does a modern taxonomist use for characterizing organisms? 3. What are some problems with using common names, such as “cat” or “starfish” or “flesh-eating shark” in classifying organisms?”

12. Traditional Taxonomic Systems –Binomial nomenclature (Two-part name) –Genus species –1 st letter of the Genus name is capitalized; species in lower case –always italicized if typed, or underlined if handwritten Carolus Linnaeus (Li-nay-us)(1707- 1778), a Swedish naturalist created rules for classification based on organism shared characteristics:

13. The Binomial System Black bear Ursus Americanus Grizzly bear Ursus horribilis What can be said about 2 species having the same genus? The same genus name indicates that these two species are closely related in anatomy, embryology and evolutionary ancestry.

14. Levels of Classification There are 8 levels or taxa (singular: taxon): Domain Kingdom Phylum Class Order Family Genus Species Can you come up with a mnemonic device for 7 taxa? King Phillip Comes Over For Great Soup

15. Taxonomic Classification of Grey Wolf- an example Becoming more specific

16. All Living Things Domain Bacteria Kingdom Bacteria Domain Archaea Kingdom Archaea Domain Eukarya Kingdom ProtistaKingdom Fungi Kingdom PlantaeKingdom Animalia Three Domains and Six Kingdoms Classification System

18. HW- Create a dichotomous key to classify 6 kingdoms

19. Dichotomous Key A step-by-step guide to help identify an organism Follows a series of choices will lead you to the organism’s name

20. 2 types of dichotomous keys: same result

21. Dichotomous key: more examples ibis heron spoonbill cardinal eagle

22. Please do Practice Exercise now Use a dichotomous key to identify creatures on planet Pamishan

23. Practice creating a dichotomous key Assign Latin-like binominal name for each deer-like creature

24. Answer Example: 1. body with large spots......go to 2 Plain body..... go to 4 2. Has 4 legs.....go to 3 Has 8 legs.......... Deerus octagis 3. Has a tail........ Deerus pestis Does not have a tail..... Deerus magnus 4. Has a pointy hump...... Deerus humpis Does not have a pointy hump.....go to 5 5. Has ears.........Deerus purplinis Does not have ears......Deerus deafus

25. Many possible answers As long as your key works With tail Without tail 1-loop tail 2-loop tail oval body humpback body ….. Deerus ovus ….. Deerus humpis body with dark spots body with faint spots ….. Deerus darkus …..Deerus tetragis ….. Deerus tailess 4 legs 8 legs….. Deerus octagis

26. Announcement Lab quiz “Classifying the Kingdom of pasta” Changed to Monday Sep 15 2014 in class, ~30 min

27. The importance of classification to Technology, Society, and the Environment Environmental conservation of organisms tracing the transmission of diseases and the development and testing of possible treatments Medical Products - helps narrow search to species closely related to organisms already known to produce valuable proteins or chemicals for medical purposes. increasing crop yields through disease and pest resistance

28. Problems with traditional taxonomy Deciding and agreeing on what criteria to use to define each taxon Internal anatomical and physiological features are more significant than external features when creating dichotomous key. However, they are difficult to observe.

29. Modern taxonomy and Phylogeny Phylogeny = the study of the evolutionary relatedness between and among species Family Tree Phylogenetic tree (also cladogram) Common ancestor Going back in time

30. 1. Which organisms in the above cladogram have hard shelled eggs? 2. Which organisms in the cladogram have a backbone? 3. Which shared a common ancestor most recently – a bird and a crocodile or bird and a monkey?

31. Looking at clades in a cladogram A clade includes a single ancestor species and all its descendents (both living and extinct)

32. Looking at clades in a cladogram A clade includes a single ancestor species and all its descendents (both living and extinct)

33. HOW TO BUILD A CLADOGRAM http://ccl.northwestern.edu/simevolution/ob onu/cladograms/Open-This-File.swfhttp://ccl.northwestern.edu/simevolution/ob onu/cladograms/Open-This-File.swf

34. Comparing traditional and modern taxonomy Based on shared physical features Based on recent shared ancestor

35. Recent advancement: International Barcode Of Life project Launched in 2010 Use DNA to create DNA profile of every species in the form of a barcode http://ibol.org/.http://ibol.org/ Paul Herbert, U of Guelph http://www.uoguelph.ca/~phebert/

36. DNA Barcoding

37. International Barcode Of Life Project DNA sequence of Arctic warbler (Phylloscopus borealis) looks like: CCTATACCTAATCTTCGGAGCAT GAGCGGGCATGGTAGGC.... And its image looks like this: Benefits of iBol project: reveals wide spread false labelling of fish products sold in Canada and US Allows low cost sampling and monitoring diversity of entire ecosystem

38. Review 1. Which group is more specific, order or class? Order 2. What is meant by binomial nomenclature? A two name system (Genus species) 3. List the 6 kingdoms in order from primitive to advanced Bacteria, Archaea, protista, fungi, plants, and animals

39. Review 4. Which of the following pairs is MOST closely related? Acer rubrum & Acer saccharum Acer rubrum & Chenopodium rubrum 5. The science of classification is called _____________

40. (1) Genetic Diversity among organisms of the same species (2) Species Diversity -Variety of species within an ecosystem and the # of individuals within each species -Helps to determine the health of the ecosystem (3) Ecosystem Diversity What are the 3 levels of biodiversity?

41. Threats to Biodiversity 1.Overhunting/Over-fishing 2.Habitat Loss 3.Invasive Species 4.Climate change Human is the cause of the current mass extinction