1. Molecular Testing and Clinical Diagnosis Amplified nucleic acid testing Part III

2. Describe and evaluate types of target sequences (DNA, mRNA, tRNA, rRNA) (C3) Describe and compare amplification processes including (C3) –Basic steps of an amplification process –Principles of methods available PCR, LCR, SDA, NASBA, TMA –List and describe the function PCR components in the reaction mix (C2) Describe the variations of PCR process (C2) –LCR –Reverse Transcription-PCR –Real time PCR Objectives: At the end of this lesson the student will:

3. Explain the application of PCR to STR testing (C2) –Paternity testing –Forensic testing –RFLP mapping Describe the significance of the following PCR considerations (C2, A2) –Contamination –Quality control –Lab space allocation Objectives: At the end of this lesson the student will:

4. Strand Displacement Amplification- BDPobeTec ET system One hour assay fluorescence detection automated and semi-automated systems pre-dispensed reagent devices

5. Strand Displacement Process step 1: primer hybridization step 2: primer extensions by DNA polymerase leads to strand displacement step 3: extended probe binds complimentary strand step 4: probe is extended creating BsoBI site step 5: BsoBI cleaves dsDNA

7. Detection linked with amplification. Target must be amplified and double stranded to enable the restriction enzyme to function. Fluorescence only occurs when there is cleavage.

8. SDA lends itself to automation since it is isothermal.

9. Transcription-Mediated Amplification l RNA transcription amplification system using two enzymes: RNA polymerase and reverse transcriptase l Isothermal amplification of nucleic acid target producing RNA product amplification l Rapid kinetics results in excess of ten billion- fold amplification within 15-30 minutes l Combined with Hybridization Protection Assay detection in a single tube format

10. Transcription-Mediated Amplification Components l Primers: Oligonucleotides that hybridize to target and initiate the reaction l Nucleotides l Enzymes drive the reaction: –T7 RNA polymerase transcribes RNA from DNA –Reverse transcriptase (MLV): synthesizes DNA from RNA or DNA RNAse H activity: degrades RNA after it has been copied into DNA

11. Transcription-Mediated Amplification

12. TMA: Gen-Probe Second Generation APTIMA TM Assays l Target Capture sample processing partially purifies target nucleic acid l Transcription-Mediated Amplification-- amplified target l Dual Kinetic Assay (DKA) technology simultaneously detects two organisms

13. .....GAUCGAUCCCCCCUAGCGGUGCAUCUAGCAUCUA.... one micron magnetic particle ––TTTTTTTTTTTTTT AAAAAAAAAAAAAAAAAA GGATCGCCACGTAGATCGGCCTC Magnet N S Bead Oligo Capture Oligo "Tail" Target Sequence Capture Sequence These are washed away: non-specific DNA/RNA Protein Cell debris Plasma Gen-Probe Proprietary Target Capture Technology

14. Detection by Dual Kinetic Assay (DKA) Technology l Hybridization Protection Assay (HPA) Technology l Two modified acridinium ester labels with different light-off kinetics on different DNA probes –“Flasher” fast –“Glower” slow –Simultaneous detection of different organisms

15. Dual Kinetic Assay (DKA) 0 20,000 40,000 60,000 80,000 100,000 120,000.04.20.36.52.68.841.001.161.321.481.641.801.96 CT + GC CT GC RLU Time in Seconds

16. 1E0 1E2 1E4 1E6 1E8 1E10 1E12 1E14 Amplicon copies 051015202530354045505560 Time (min.) TMA Amplicon Production Starting with 1000 copies of Target TMA Amplicon Production

17. Gen-Probe Instrumentation Systems l Fully automated, APTIMA TM amplification assays for TIGRIS TM l Target Capture system l VIDAS* dual platform: Amplified assays and immunoassays *from bioMérieux

18. Challenges with Current Nucleic Acid Amplification Tests l Carry-over contamination can cause false positives l Verification of positive results is difficult l Inhibition can cause false negatives l Compared with current microbiology tests: –Increased labor –Higher cost –Low throughput

19. Methods for Control of Carryover Contamination in automated TMA Assays l Unidirectional workflow l Single-tube format l Oil as a barrier to the environment l HPA format eliminates wash steps and potential aerosols l Treatment of RNA amplicon with detection reagents l Bleach destroys nucleic acids

20. Comparison of TMA with PCR and LCR Amplification Methods TMA (Gen-Probe )PCR (Roche )LCR ( Abbott ) Thermal Conditions Isothermal reactionThermal cycling Amplified Product RNADNA Wash step Homogeneous assay no wash steps Wash step required Wash step required Detection SystemChemiluminescenceAbsorbanceFluorescence Special equipment needed Luminometer Thermal cycler, microtiter plate reader/washer Thermal cycler, LCx instrument RNA polymerase Reverse transcription DNA polymerase Ligase DNA polymerase Enzymes

22. Step One Step One Sample Processing Extract RNA ~ 90 minutes ~ 90 minutes (Hybridized target captured on to microparticles) Gen-Probe HIV-1/HCV dual- assay protocol for blood supply Step Two Step Two TMA Add Amplification Reagent, Oil Reagent 10 minutes 41.5°C Add Reverse Transcriptase, RNA Polymerase 60 minutes 41.5°C Step Three Step Three HPA Add Probe Reagent (Hybridizes to amplicon) 15 minutes 60°C Add Selection Reagent 10 minutes 60°C Read in Luminometer

23. Pooling Scheme 128 Donations 16 128 Pool

24. 1111111 Resolution Testing Identification of Single Donation 16 Reactive Pool 1111111 1 1 Test Primary Pools 128

25. HCV Panel 6211 – Virologic/Serologic Profile Days S/CO HCV PCR Quantitation 46 Days PCR E991685 7-14-99 25

26. Summary: Amplification Methods Much like a culture technique, they increase likelihood of detection and identification Enzymes are used to increase target sequence for detection May be automated or semi-automated more easily if isothermal

27. Summary Amplification Methods Increased sensitivity –amplification –detection systems Specificity –primers –probe/detection systems