Presentation is loading. Please wait.

Presentation is loading. Please wait.

Targeting duplex DNA: strategies and applications Maxim Frank-Kamenetskii Boston University reprints at:

Similar presentations


Presentation on theme: "Targeting duplex DNA: strategies and applications Maxim Frank-Kamenetskii Boston University reprints at:"— Presentation transcript:

1 Targeting duplex DNA: strategies and applications Maxim Frank-Kamenetskii mfk@bu.edu Boston University reprints at: http://www.bu.edu/cab

2

3 How can we sequence- specifically target the DNA duplex?

4 H DNA Triplex  Displaced strand   Displaced strand 1985

5 base triads Hoogsteen pairing Watson-Crick pairing Hoogsteen pairing Watson-Crick pairing

6 The DNA double helix minor groove  major groove 

7 Old-fashioned single-molecule experiment JMB 1993

8 PNA as a tool for targeting duplex DNA

9 Peptide Nucleic Acid carries is the same bases as DNA (red), but has a totally different protein-like backbone (blue) PNA – A DNA Mimic with Unique Properties DNAPNA Nielsen et al. 1991

10 PNA features  Neutral backbone  Stronger and faster binding to nucleic acids  Strand invasion into duplex DNA  High sequence-specificity  No peptide  no degradation by protease  No nucleic acid  no degradation by nucleases

11 PNA/DNA duplexes are more stable than DNA/DNA duplexes

12 Peter Lansdorp (University of British Columbia, Canada) FISH of telomeres using PNA

13 PNA FISH for bacterial detection AdvanDx Inc., Woburn, MA Staphylococcus aureus (green)

14 PNA openers Triplex Invasion Double Duplex Invasion Pseudocomplementary pcPNA any base composition Homopyrimidine PNA

15 base triads Hoogsteen pairing Watson-Crick pairing Hoogsteen pairing Watson-Crick pairing

16 A pair of pseudocomplementary PNAs (pcPNAs) invade into the DNA double helix in a strictly sequence-specific manner PNAS 2004

17 Triplex Invasion into Duplex DNA by PNA “Openers” PNA “opener”: Two homopyrimidine PNA oligomers connected by a flexible linker (bis-PNA) Homopurine site within dsDNA dsDNA Triplex Invasion Complex “ P-loop “ H-Lys 2 -JJTJTJTT H 2 N-Lys -CCTCTCTT linker Example: Hoogsteen pairing Watson-Crick J bases eliminate pH dependence of triplex invasion G C J H N O N N N N R H N N N R O H H H H H H N O N N R H H H J*G:C (pH7)C*G:C (pH5) Hoogsteen pairing C C+C+ G H N O N N+N+ R HH H N O N N N N R H N N N R O H H H H H H H Watson-Crick + ++

18 Targeting duplex DNA through PD-loop N=4-10 5'3' 5' NH 2 COOH PNA openers = 6-10  Two PNA openers are able to sequence-specifically hybridize to complementary target sites in duplex DNA  DNA probe can hybridize to the displaced strand forming a stable complex 5' 3' PD-loop PNAS 1998

19 Capturing duplex DNA using PD-loop Capturing a fragment from the entire yeast genome PD-loop PNAS 1998

20 Applications of PNA openers

21 .............................................. PNA openers and some of their applications dsDNA bis-PNA openers Locally open dsDNA Hybridization of DNA or PNA beacon....................................... Q F DNA detection................ DNA sequencing, Ligand Mapping........................................ “Artificial primosome” Hybridization/extension of primer.................. homopyrimidine sequence

22 Molecular beacons JACS 2002

23 DNA polymerase pausing due to drug binding to dsDNA Nascent DNA strand PNA openers DNA polymerase ligand JMB 2003

24 Mapping drug’s binding sites on dsDNA via artificial primosome PNA I  PNA II 

25 DNA detection using PNA openers

26 PD-loop as a tool for detection of short signature sites

27 New methods of DNA-based detection AEM 2007 BMC 2007

28 Proof-of-principle studies on bacterial cells chosen signature sites: 21-nt-target site in E.coli cold shock protein gene GGAGAGAGACTCAAAAGAAGG 23-nt-target site in B.subtilis the phosphoglycerate dehydrogenase gene GAAAAGAAACCCTTCAGAGGAAG 22-nt-target site in S.mutans the wall-associated protein gene AAAAGAGGTATTTTAAGAGGAA (PNA binding sites are underlined) These sites are unique for each of the bacteria throughout the Bacterial Genomes Database E.coli B.subtilis S.mutans AEM 2007

29 Potential Application:Viral DNA Detection

30 Solid-state nanopore NanoLetters 2010

31

32 Duplex DNA labeling using nicking enzymes NAR 2008

33 PNA openers Triplex Invasion Double Duplex Invasion Pseudocomplementary pcPNA any base composition Homopyrimidine PNA

34  - PNA ArtDNA 2010

35 Capturing duplex DNA using PD-loop Capturing a fragment from the entire yeast genome PD-loop PNAS 1998

36 Affinity capture using  -PNA: linear dsDNA ArtDNA 2010

37 Affinity capture using  -PNA: supercoiled DNA (scDNA) ArtDNA 2010

38 Acknowledgements Boston University Irina Smolina Heiko Kuhn Nancy Miller Amit Meller and his group Harvard Medical School Charles Lee US Genomics Katya Protozanova Gary Jaworski Rhea Mahabir Copenhagen University Peter Nielsen Carnegie Mellon University Danith Ly Funding: Wallace H. Coulter Foundation. NIH


Download ppt "Targeting duplex DNA: strategies and applications Maxim Frank-Kamenetskii Boston University reprints at:"

Similar presentations


Ads by Google