Download presentation
Presentation is loading. Please wait.
Published byLionel Johnston Modified over 9 years ago
1
Company LOGO Magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake Jian Liu, Bo Wang, Sandy Budi Hartono Biomaterials University of Queensland, Australia
2
www.themegallery.com, contents Introduction Experimental Section Results and Discussion Conclusions
3
www.themegallery.com, Introduction Mesoporous materials Large specific surface area Large pore volume Uniform pore size distribution Mesoporous silica nanoparticles (MSNs) Biocompatibility Low toxicity Catalysis Imaging Drug delivery Biological application
4
www.themegallery.com, Introduction Other properties that MSNs required for biological application Large pore sizes Appropriate magnetic properties Appropriate functional surface
5
www.themegallery.com, Introduction 1 、 Large pore size Large internal surface Large mesoporous volume Cytochrom C 2.6×3.2×3.3 nm a-L-arabinofuranosidase 3.9×9.7×14.4 nm Suitable pore sizes for immobilisation of these proteins can vary from10 to 50 nm
6
www.themegallery.com, Introduction 2 、 Magnetic properties Bioseparation Cell sorting Diagnostic analysis Simultaneous imaging and drug delivery
7
www.themegallery.com, Introduction Preparation methods : Large pore size mesoporous materials Templates : Pluronic P123 Swelling agent : 1,3,5-trimethyl benzene (TMB) or alkanes Condition : Strong acidic Magnetic mesoporous materials Templates : Brij56 micelles Condition : Basic
8
www.themegallery.com, Introduction 3 、 Functional surface To delivery nucleic acids, the silica surface with positive charge is needed to electrostatically bind DNA and RNA molecules Methods : Functionalisation with amine-derivative group such as APTES Conjugations with cationic polymers such as PEI
9
www.themegallery.com, Introduction Develop synthesis methods to prepare MSNLP Establish a surface functionalisation method to enable adsorption and delivery of nucleic acids
10
www.themegallery.com, Experimental Section Synthesis of monodisperse superparamagnetic Fe 3 O 4 nanocrystals Fe 3+ 1-octadecene Iron stearic acid 1,2-hexadecanediol + Static conditions at 250 ℃ in a Teflon-lined autoclave for 6~12 h The concentration of the magnetic nanocrystals is 10 or 30 mg/ mL and suspended in hexane
11
www.themegallery.com, Experimental Section Synthesis of magnetic silica nanospheres with large nanopores 30-glycidox-ypropyltrimethoxysilane (GOPS) PLL
12
www.themegallery.com, Experimental Section DNA adsorption CpG DNA 1826 (5‘ to 3‘, TCCATGACGTTCCTGACGTT ) Measuring A260 absorbance at 260 nm Transfection of cells Cy TM 3-labeled miRNA Rat kidney epithelial cells (NRK-52E)
13
www.themegallery.com, Results and Discussion Synthesis of magnetic silica nanospheres with large nanopores
14
www.themegallery.com, Results and Discussion Fig. 1. SEM (a, c), TEM (b, d-f), and HRTEM (g, h) images of MSNLP synthesised with different amount of hexane: MSNLP-0-350 (a, b), MSNLP-10-350 (c, d), MSNLP-10-700 (e), MSNLP-10-1400 (f-h).
15
www.themegallery.com, Results and Discussion
16
www.themegallery.com, Results and Discussion Brij56: polyoxyethylene 10 cetyl ether, C 16 H 33 EO 10 N 0 I 0 route
17
www.themegallery.com, Results and Discussion Magnetic properties of magnetic silica nanospheres with large nanopores
18
www.themegallery.com, Results and Discussion Fig. (A) Field-dependent magnetisation at 300 K of MSNLP with different amounts of magnetite: a) MSNLP-10-350, b) MSNLP-10-700, c) MSNLP-10-1400, and d) MSNLP-30-1400; and (B) the separation process of MSNLP-30-1400 nanospheres from solution by magnet (right picture) and their re-dispersion by as slight shake (left picture).
19
www.themegallery.com, Results and Discussion Composition of PLL functionalised MSNLP
20
www.themegallery.com, Results and Discussion Adsorption of DNA on PLL functionalised magnetic silica nanospheres with largenanopores MSNLP-0-350-PLL q m =22.5μg/mg MSNLP-10-350-PLL q m =15μg/mg MSNLP-10-1400-PLL q m =10μg/mg
21
www.themegallery.com, Results and Discussion Fig. Left panel a-d, cells transfected with fluorescent oligonucleotide only; middle panel e-h, cells transfected with nanoparticles alone; and right panel i-l, cells transfected with nanoparticles loaded with fluorescent oligonucleotide. From top to bottom: cy5 channel - images of fluorescence of Cy TM 3 labeled miRNA (red), F-actin - images of F-actin stained by FITC-Phalloidin (green), DAPI - images of nuclei stained with DAPI (blue), and merge - the merged picture.
22
www.themegallery.com, Conclusions Magnetic silica nanospheres with large nanopores(13-20 nm) were synthesised for the first time The saturation magnetisation values can be conveniently controlled by changing the amount of Fe 3 O 4 magnetic nanocrystals encapsulated After functionalisation with PLL, high adsorption capacity ranging from 10 to22.5 μg/mg for CpG DNA and efficient cellular delivery capability for miRNA were achieved The materials synthesised in this study could find broad applications
23
www.themegallery.com, Thank You
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.