Presentation is loading. Please wait.

Presentation is loading. Please wait.

Protein Synthesis Making Proteins

Similar presentations


Presentation on theme: "Protein Synthesis Making Proteins"— Presentation transcript:

1 Protein Synthesis Making Proteins

2 Bodies  Cells  DNA Bodies are made up of cells
All cells run on a set of instructions spelled out in DNA

3 DNA  Cells  Bodies How does DNA code for cells & bodies?
how are cells and bodies made from the instructions in DNA

4 DNA  Proteins  Cells  Bodies
____________________________________ _____________ proteins cells DNA gets all the glory, Proteins do all the work bodies

5 How do proteins do all the work
____________________ proteins run living organisms __________________ control all chemical reactions in living organisms all living organisms are built out of proteins

6 Cell organization DNA ________________________
genes = instructions for making proteins want to keep it there = protected “locked in the vault” nucleus nucleus

7 Cell organization Proteins ___________________________
________________________________________ cytoplasm nucleus build proteins nucleus

8 Passing on DNA information
Need to get DNA gene information from nucleus to cytoplasm ___________________________ cytoplasm nucleus build proteins nucleus ribosome

9 From nucleus to cytoplasm
______________ DNA mRNA protein ________________ trait nucleus cytoplasm

10 DNA vs. RNA _______ _______ deoxyribose sugar nitrogen bases
_____________ C : G ________________ _______ ribose sugar nitrogen bases _____________ C : G ________________

11 Transcription _____________________
DNA strand is the template (pattern) match bases U : A G : C Enzyme RNA polymerase

12 Matching bases of DNA & RNA
Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

13 Matching bases of DNA & RNA
Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

14 Matching bases of DNA & RNA
Match RNA bases to DNA bases on one of the DNA strands C U G A G U G U C U G C A A C U A A G C RNA polymerase U A G A C C T G G T A C A G C T A G T C A T C G T A C C G T

15 Matching bases of DNA & RNA
U instead of T is matched to A DNA TACGCACATTTACGTACGCGG mRNA AUGCGUGUAAAUGCAUGCGCC ribosome U C A G

16 cytoplasm protein nucleus ribosome trait U C A G

17 How does mRNA code for proteins
mRNA leaves nucleus mRNA goes to ribosomes in cytoplasm ____________________________________ How? mRNA U C A G aa

18 How does mRNA code for proteins?
TACGCACATTTACGTACGCGG DNA ribosome AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein aa How can you code for 20 amino acids with only 4 DNA bases (A,U,G,C)?

19 mRNA codes for proteins in triplets
TACGCACATTTACGTACGCGG DNA codons ribosome AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein ________________________________

20 The mRNA code For ALL life! Code has duplicates Start codon
strongest support for a common origin for all life Code has duplicates several codons for each amino acid mutation insurance! Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG

21 How are the codons matched to amino acids?
TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA codon UAC Met GCA Arg tRNA CAU Val anti-codon amino acid ________________________________

22 mRNA to protein = Translation
__________________________________ ribosome mRNA U C A G aa tRNA G U aa tRNA U A C aa tRNA G A C tRNA aa A G U

23 mRNA protein DNA trait From gene to protein tRNA _______________
aa _______________ _______________ mRNA protein DNA ribosome U C A G tRNA aa trait nucleus cytoplasm

24 cytoplasm transcription transcription transcription nucleus transcription

25 From gene to protein protein transcription translation

26 Whoops! See what happens when your genes don’t work right!
Any Questions??


Download ppt "Protein Synthesis Making Proteins"

Similar presentations


Ads by Google