2. Unit 8 Molecular Genetics and Biotechnology

3. Main Idea DNA codes for RNA, which guides protein synthesis From Genes to Genetic expression (The central dogma of molecular biology)  DNA->RNA->amino acid->protein-> genetic expression

4. Protein Synthesis  Amoeba Sister Protein Synthesis  http://www.youtube.com/watch?v=h5mJbP23Buo http://www.youtube.com/watch?v=h5mJbP23Buo  Answer the following questions in your notes as you view the video

5. Video Questions  1. DNA codes for traits (Proteins)  2. What does Protein Synthesis make? Proteins  3. Yes or No: Is all the DNA turn on all the time?  4. DNA is located in the Nucleus  5. What are the 2 step in Protein Synthesis? Transcription Translation  6. How many letters are read at a time? 3

6. Roles of RNA and DNA  DNA is the MASTER PLAN  RNA is the BLUEPRINT of the Master Plan 5

7. DNA vs RNA DNA  Sugar-Deoxyribose  Double Stranded  Nitrogen Bases: Adenine, Thymine, Gaunine, Cytosine,  Difference: Thymine  G,C,A,T RNA  Sugar Ribose  Single Stranded  Nitrogen Bases: Adenine, Uracil, Guanine, Cytosine  Difference: Uracil  G,C,A,U

8. RNA & Protein Synthesis DNA remains in the nucleus, but in order for it to get its instructions translated into proteins, it must send its message to the ribosomes where proteins are made.  There a 3 types of RNA involved in this process  mRNA:  tRNA:  rRNA

9. RNA structures mRNAtRNA rRNA

10. Comparison of 3 Types of RNA  mRNA: Carries genetic information from DNA in the nucleus to direct protein synthesis in the cytoplasm. (codon)  tRNA: Carries specific amino acids to the ribosomes. (Anti-codon)  rRNA: molecular component of a ribosomes. (the site of protein synthesis)

11. Moving the information from DNA to Proteins

12. 2 Main Steps in Protein Synthesis  1. Transcription: Takes place in the nucleus, mRNA reads the DNA strand, then moves to the cytoplasm for translation.  2. Translation: Take place in the cytoplasm, tRNA carries amino acids to the mRNA to the site of a ribosome (rRNA)  In RNA Adenine pairs with Uracil(A-U) Guanine pairs with Cytosine(G-C)

15. How does mRNA code for proteins? How can you code for 20 amino acids with only 4 DNA bases (A,U,G,C)? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla Protein ? Ribosome aa

16. mRNA Codes for Proteins in Triplets AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla Protein Codon = block of 3 mRNA bases TACGCACATTTACGTACGCGG DNA Ribosome Codon

17. How are the Codons Matched to Amino Acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Anti-codon Codon tRNA UAC Met GCA Arg CAU Val Anti-codon = block of 3 tRNA bases Amino Acid

18. mRNA to protein = Translation  The working instructions  mRNA  The reader  ribosome  The transporter  transfer RNA (tRNA) mRNA UCCCCCCAAUGUGAAAAAGGGGUU aa tRNA GG U aa tRNA UAC aa tRNA GA C aa AGU Ribosome

20. Another Codon Chart You May See

21. Protein Synthesis

22. DNA replication (Nucleus) Transcription Nucleus Translation (Cytoplasm on the Ribosome) DNA Mutation (Nucleus)

23. Nucleus Protein Transcription Cytoplasm Translation Trait

24. Transcription Translation Protein

25. Protein Synthesis Worksheet:

26. Mutation Video  http://www.youtube.com/watch?v=GieZ3pk9YVo http://www.youtube.com/watch?v=GieZ3pk9YVo

27. Mutations: Mutation can be harmful, helpful or neutral in their effect. Mutations create genetic variation

31. Mutations are ANY changes in the genetic material. A mutation that occurs in the gametes will most likely transferred to the offspring

32. Types of Gene Mutations  Include:  Point Mutations: Change of a single nucleotide. Include: 1. Substitution: Change in the nucleotide 2. Frameshift: insertion or deletion of a single nucleotide

33. Gene Mutations: Substitution  Gene mutations result from changes in a single gene.  A change in one base; aka point mutation.  In substitution, one base replaces another. Substitution

34. Gene Mutations: (Frameshift) Insertion/Deletion  In an insertion, an extra base is inserted into the base sequence.  The loss of a single letter shows the effect of a deletion. Shifts right or left in reading frame = Frameshift mutation Insertion Deletion

35. Mutation TypeAnalogy SentenceExample of Associated Disease NormalTHE BIG FAT CAT ATE THE WET RAT Missense (substitution) THE BIZ FAT CAT ATE THE WET RAT Achondroplasia: improper development of cartilage on the ends of bones of arms and legs resulting in a form of dwarfism Nonsense (substitution) THE BIG RAT Muscular Dystrophy: progressive muscle disorder characterized by the progressive weakening of many muscles in the body Deletion (causing frameshift) THB IGF ATC ATA TET HEW ETR AT Cystic fibrosis: characterized by abnormally thick mucus in the lungs, intestines, and pancreas Insertion (causing frameshift) THE BIG ZFA TCA TAT ETH EWE TRA Crohn’s disease: chronic inflammation of the intestinal tract, producing frequent diarrhea, abdominal pain, nausea, fever, and weight loss DuplicationTHE BIG FAT FAT CAT ATE THE WET RAT Charcot-Marie-Tooth disease (type 1A): damage to peripheral nerves leading to weakness and atrophy of muscles in hands and lower legs. Expanding mutation (tandem repeats) Generation 1 Generation 2 Generation 3 THE BIG FAT CAT ATE THE WET RAT THE BIG FAT CAT CAT CAT ATE THE WET RAT THE BIG FAT CAT CAT CAT CAT CAT CAT ATE THE WET RAT Huntington’s disease: a progressive disease in which brain cells waste away, producing uncontrolled movements, emotional disturbances, and mental deterioration

36. Chromosome Mutations  Five types exist:  Deletion: removes a chromosome segment  Inversion: reverses a segment within a chromosome  Translocation: moves a segment from one chromosome to another, non-homologous one  Duplication: repeats a segment  Non-disjunction: chromosomes fails to separate properly during meiosis

37. Chromosome mutations creates genetic variation

38. Mutation Worksheet

39. QUIZ TIME 1.The diagram shows the normal sequence of genes in a particular chromosome. Which chromosomes could have resulted from a deletion that occurred in this chromosome?

40. Applied Genetics: is the manipulation; of the hereditary characteristics of an organism to improve or create specific traits in offspring.  Selective breeding: directed breeding to produce plant and animal with desirable traits. Ex: breeding plants to produce larger fruits/vegetable  Inbreeding: Two closely related organism are bred to have the desired traits and to eliminate the undesired ones in future generations

41. Applied Genetics Copyright © McGraw-Hill Education Test Cross A test cross involves breeding an organism that has the unknown genotype with one that is homozygous recessive for the desired trait. If the unknown parent genotype is homozygous dominant, all the offspring will have the dominant phenotype. If the unknown parent genotype is heterozygous, the offspring will show a 1:1 phenotypic ratio.

42. DNA Technology Copyright © McGraw-Hill Education Genetic Engineering Genetic engineering is technology that involves manipulating the DNA of one organism in order to insert the DNA of another organism. Genetically engineered organisms are used to: Study the expression of a particular gene Investigate cellular processes Study the development of a certain disease Select traits that might be beneficial to humans DNA Tools Genetic engineering can be used to increase/decrease the expression of specific genes in selected organisms. An organism’s genome is the total DNA in the nucleus of each cell.

43. Gel Electrophoresis  1. DNA is cut into smaller pieces using restriction enzymes  2. An electrical current is applied  3. DNA is separated by size. Shorter fragments move farther down the get than longer fragments Used in: DNA fingerprinting

44. Best way to determine if two people are genetically related Used in genetic counseling, parental testing, crime scenes, classification of new species of organisms. Can you tell… Organism X is most closely related to which sample? X 1 2 3 4 DNA fingerprinting

45. Which one is the correct father?

46. Gel Electrophoresis (example)  Look at the example of DNA taken at the crime scene (Column 1).  Which suspect committed the crime?  Suspect A  Suspect B  Suspect C

47. DNA Technology Copyright © McGraw-Hill Education Biotechnology Biotechnology is the use of genetic engineering to find solutions to problems. Organisms with genes from other organisms are called transgenic organisms. Transgenic animals, plants, and bacteria are used for research, medicine, and agriculture.

48. HUMAN Genome Project  Goal for the Human Genome Project was to sequence all the nucleotides in the human body. (3 Billion nucleotides and 20,000-25,000 genes)  This was completed in 2003  Haplotypes: linked variations in the human among populations in different part of the world.  AKA: HapMap project

49. Bioinformatics  The Human Genome Project and other sequencing projects produce enormous amounts of data.  Bioinformatics involves creating and maintaining databases of biological information. The Human Genome Copyright © McGraw-Hill Education

50. The Genome and Genetic Disorders Pharmacogenomics  The study of how genetic inheritance affects the body’s response to drugs is called pharmacogenomics.  The benefits of pharmacogenomics include more accurate dosing of drugs that are safer and more specific to individuals. Gene therapy  Gene therapy is a technique aimed at correcting mutated genes that cause human diseases.  Scientists insert a normal gene into a chromosome to replace a dysfunctional gene. The Human Genome Copyright © McGraw-Hill Education

51. Genomics and Proteomics  Genomics is the study of an organism’s genome  Involves identifying genes and proteins produced by these genes.  Proteomics is the large-scale study and cataloging of the structure and function of proteins. The Human Genome Copyright © McGraw-Hill Education

52. Nucleus aa mRNA What have we learned: From Gene to Protein: Review DNAProtein Trait UCCCCCCAAUGUGAAAAAGGGGUU Ribosome tRNA aa TranscriptionTranslation Cytoplasm

53. Mutations Single Nucleotide MutationsChromosome Mutations Non-disjunction

54. Biotechnology: is the use of genetic engineering to find solutions to problems.