1. Page 1 Competitive Interaction

2. Page 2 Strategic Management…Action that Creates Value Pazzo’s Lynagh’s Pub Lynagh’s Pub

3. Hardball? Competitive Outcomes Industry Characteristics Organizational Characteristics

4. Page 4 Dethronement of the Leader MarketShare 1950 1960 1970 1980 1990 2000 Wal-Mart Sears JC Penney

5. Page 5 Dethronement of the Leader Market Share 1950 1960 1970 1980 1990 2000 McDonnell- Douglass Boeing Airbus

6. Page 6 Dethronement of the Leader Market Share (U.S.) 1980 1990 2005 Adidas Nike Reebok

7. Page 7 King of the Hill – Fizzy Beverages Market Share 1970 1980 1990 2000 2010 2020 Other ? Coke Pepsi

8. Page 8 Simple Rivalry: Prisoner’s Dilemma What to say to police? Criminal 1 Criminal 2 Confess Keep Quiet Both Serve 1 Year in Jail Both Serve 5 Years in Jail #2 Serves 10 Years in jail #1 Goes Free #1 Serves 10 Years in Jail #2 Goes Free

9. Page 9 Three Stooges Larry, Moe, and Curley are in a 3-way duel and agree to take turns shooting each other, in that order Accuracy statistics: – Larry hits target 20% of the time – Moe hits target 80% of the time – Curley hits target 100% of the time When the duel starts, what should Larry do?

10. Page 10 Competitive Intelligence A systematic and ethical program for gathering information about competitors and general business trends to further your own company’s goals

11. Page 11 Why CI? Play the Game Differently New market opportunity New customers Develop/leverage new value chain strengths New strategies/tactics New “flow” of the game Figuring out what drives behavior Environment/industry drivers Organizational drivers Managerial drivers Playing the Game Better Focus on existing competitors/strategic position Leverage value chain strengths Incrementally improve existing strategies/tactics

12. Page 12 Competitor Intelligence Pyramid s z a Sources of Data Analysis of Data Recommendations

13. Page 13 Recommendations Analysis of Data Sources of Data Competitor Intelligence Pyramid Industry experts/analysts Industry publications Trade shows/conferences Advertisements/PR University research centers Financial Court documents/patents Suppliers/customers Newspapers Help wanted ads Reverse engineering labs

14. Page 14 Your Rival’s News-based Competitive Actions July-October 2009 Contract with Spike Lee for TV ad Increase R&D budget by 30% Buy warehouse facility near airport in Germany, Re-tool with robotic material handling system License Oracle’s newest technology Cut prices on older version of product by 33% Endorsement contract with famous World Cup soccer athletes Create multifunctional new product design team

15. Reverse Engineering – Your Rival’s Product Page 15

16. Page 16 Recommendations Analysis of Data Sources of Data Competitor Intelligence Pyramid Value chain analysis Ratio analysis Benchmarking Cost analysis Trend analysis Personality profiling Wargaming or scenario planning Competitive behavior analysis

17. Page 17 Recommendations Analysis of Data Sources of Data Competitor Intelligence Pyramid Track Existing Rivals Anticipate New Rivals Inform Strategy: –Identify own/competitor’s strengths/weaknesses –Early warning system –Plan of attack/retaliation

18. Page 18 The Cola Wars

19. Page 19 Coke’s Market Share MKT PRICEPRODMKTCAPSIG PROD Competitive Action Repertoire The set of competitive actions carried out in a given time period Repertoire

20. Page 20 Your Rival’s Competitive Actions Contract with famous movie director, Spike Lee, for TV ad Increase R&D budget by 30% Buy warehouse facility near airport in Germany, Re-tool with robotic material handling system License Oracle’s newest technology Cut prices on older version of product by 33% Endorsement contract with famous U.S. Olympic athletes Create multifunctional new product design team abcde

21. Page 21 Competitive Dynamics Analysis Observe competitive moves Organize competitive moves –Action/response pairs –Action repertoires (year-end tallies) –Competitive attacks/sequences Measurement/Analysis of Characteristics – – Action pattern characteristics that improve: Market share Stock price Profitability

22. Action Pair 1 Action Pair 2 Action Pair 3 Action Pair 4 Coca-Cola Pepsi Action-Reaction “Pairs” time Action Response ProfitsProfits GrowthGrowth Mkt. ShareMkt. Share a cd e d d ac

23. Action “Repertoires” time Profits Growth Mkt. Share Year-End Tallies Total Actions Complexity Coca-Cola Pepsi a c e cc a ac d

24. a b c d e f g h Strategy and Adaptive Maneuvering 8765432187654321 Chess : Epaulette’s Mate Sicilian Defense

25. Sequence Applications... LANGUAGE: BOXING: DNA: qcheaTiueissesne. hsiT si a cesneueq. This is a sequence. Jab...Jab…Uppercut CAGTACATAGTACGATACGA MUSIC: COMPUTER PROGRAM: data actions2; subj = _n_; do i = 1 to max; output = matrix; end; run;

26. Page 26 a b c d e cabecabdecabd CokePepsi d aa b e c e b a d b cc Observed Sequence Competitive Actions Over Time

27. Page 27 a b c d e cabecabdecabd CokeIndustry Norm d aa b e c e b a d b cc Observed Sequence Coke Strategic Non-Conformity

28. Page 28 a b c d e cab e cabdecabd Pepsi d aa b e c e b a d b c c Observed Sequence Pepsi Strategic Conformity Industry Norm

29. Page 29 a b c d e cabecabdecabd Coke in time 1 d e b aaa d b b e c c c Coke in time 2 Observed Sequence Coke Strategic Unpredictability

30. Page 30 a b c d e cabecabdecabd d e aaa d b b e cc c Pepsi in time 1 Pepsi in time 2 b Observed Sequence Pepsi Strategic Predictability

31. Page 31 King of the Hill – Fizzy Beverages MarketShare 1950 1960 1970 1980 1990 2000 Other ? Coke Pepsi

32. Page 32 “Hardball” Competition Total Actions –More actions are better Average Response Time –Faster response time is better Repertoire Complexity –Complex repertoire is better Attack [Un-]Predictability –Unpredictability is better

33. Page 33 Group Exercise: Coke vs. Pepsi Total Actions –Count of total actions Average Response Time –Avg. number of time units between last competitive move in Coke’s attack and Pepsi’s first competitive response, etc. Repertoire Complexity –Extent to which entire pattern/repertoire is skewed/simple vs. balanced/complex Attack [Un-]Predictability –Recognizable repetition or action combinations in the sequence of actions?

34. Page 34 Scoring the Fight Total Actions Faster Responses More Complex Repertoire Unpredictable Attacks Coke Pepsi Who will win?

35. Page 35 Implications for CI: Predict Future Behavior of Rivals Rivals’ prior behavior Patterns Tendencies Type & order of moves Proactiveness Reactiveness Drivers of Behavior Management orientation Decision-making Financial constraints Industry characteristics

36. Page 36 Implications for CI: Monitor Your Own Behavior Objectively measures of competitive behavior Safeguard against complacency, predictability, simplicity of your own company Keep rivals off balance / disruption / guessing What combinations of moves are effective? …which are ineffective? …smoke signals or bluffs?