1. DNA F INGERPRINTING & B ARCODING Reminder: paraphrase info on slides (don’t just copy!) PowerPoint is in the Honors Bio section of the “documents” page of my website Time for questions at end

2. S USHI, H ONESTY, AND B ARCODING What happened in the NY Times article? Sent tissue samples of fish to be compared to “barcoded” species 2015: about 10,000 fish species have a DNA “barcode” Used for sample ID If your samples match a “barcode”, species is identified

3. DNA BARCODING & FINGERPRINTING : O VERVIEW – HOW DOES THIS WORK IN GENERAL ? DNA varies between and within species Ex) Between: Chimps and humans share about 96% of their DNA (4% varies between humans and chimpanzees) Ex) Within: All humans share about 99.9% of DNA with other humans (0.1% varies between individuals within a species) How to determine differences between or within species? Don’t write these down now – just listen (more later) Sample DNA Cut up DNA into short sections Look at differences in sections of different samples/individuals Big differences = less related species or individuals Similarities = more related species or individuals

4. DNA BARCODING & FINGERPRINTING : O VERVIEW – M ORE S PECIFIC S TEPS (P ARAPHRASE THESE …) 1) Sample DNA from unknown specimen 2) Cut up DNA using “restriction enzymes” Pieces of DNA are known as “restriction fragments” 3) Make lots of copies of restriction fragments Need lots of fragment copies to make DNA visible Fragments (DNA) useful in barcoding 4) Either 4a) Run DNA samples on a “gel” (similar lab coming soon!) Compare patterns Similar patterns = similar species/individuals 4b) Determine DNA sequences directly (won’t do this)

5. DNA BARCODING & FINGERPRINTING : R ESTRICTION E NZYMES What did you learn about restriction enzymes? Harvested from bacteria Cut DNA samples at specific sequences Ex) GAATTC CTTAAG Hundreds of known RE cut at different sequences Different RE have different purposes Animation

6. DNA BARCODING & FINGERPRINTING : C OMPARING RESTRICTION FRAGMENTS Note: summary of this page on next slide (don’t copy) How would restriction fragments from DNA samples taken from two identical twins compare? Identical! How would restriction fragments from DNA samples taken from two different species compare? Very different How would restriction fragments from DNA samples taken from two different individuals in the same species compare? Similar, but could tell the samples apart (could identify the individual)

7. DNA BARCODING & FINGERPRINTING : C OMPARING RESTRICTION FRAGMENTS Samples Restriction Fragments Identical twins  Identical fragments Different species  Very different fragments Different individuals, Similar fragments, but same species  can tell individuals apart

8. DNA BARCODING & FINGERPRINTING : G EL E LECTROPHORESIS What do you know about electrophoresis? How it works: 1) Get DNA samples, copy/replicated DNA 2) Add a known RE, produce restriction fragments 3) Add samples with fragments to agar gel (in wells)

9. DNA BARCODING & FINGERPRINTING : G EL E LECTROPHORESIS 4) Apply a charge to the gel DNA is negative, so it is attracted to… …the positive end 5) Smaller restriction fragments move… …faster and farther

10. DNA BARCODING & FINGERPRINTING : G EL E LECTROPHORESIS Small fragments = long distance Large fragments = short distance Show up as bands in a gel Which ones are smallest fragments? top

11. DNA BARCODING & FINGERPRINTING : G EL E LECTROPHORESIS Similar band pattern = similar individual Can use bands to determine differences as small as a single base! Which two samples come from the same individual? 3 and 6 Animation

12. DNA BARCODING & FINGERPRINTING : G EL E LECTROPHORESIS AND P ROBES What are probes? Probe: fluorescent or radioactive labeled section of single stranded DNA, complimentary to strand of interest (e.g. a gene) Using probes 1) Run gel 2) Add probes 3) Probes show locations of specific sequences (e.g., a gene) Animation

13. DNA BARCODING & FINGERPRINTING : G EL E LECTROPHORESIS AND P ROBES Where will probe bind? CCGTA Single stranded DNA fragments on a gel TAGGATCCTAGCATAGGCATTTCTA CCGTA No band visible Band No band visible visible Well DNA Movement 

14. Q UESTIONS ? Review notes with your neighbor – in a minute I’ll take questions…