1. Cloning and Expression of Phytase (PhyA) Gene for supplementation of Poultry :By Dalia Abu Issa Supervisor: Dr.Fawzi Razem

2. Outlines: Introduction Statement of problem Aim of study Material and Methods Results and Discussion Conclusion Future work

3. Introduction Poultry Because poultry products are in demand around the world; and because chickens and other poultry can be reared in almost any part of the world, a renewed interest in poultry projects in all fields.

4. Poultry in Palestine There is a large commercial chicken industry in palestine We depend on chicken that provides us as a first supply with eggs and meat.

5. Poultry Food Feed for poultry mostly consists of grain. Which consist of P, Ca, zinc,magnesium and iron, What is the problem?

6. Statement of problem plant especially bran and seeds store 80% of P as Phytic acid The problem is poultry have not the enzyme phytase that can librate P from its storage as phytic acid.

7. Statement of problem So farmers add inorganic P to the poultry feed in order to utilize it result in execration of all Inorganic P in their manure to cause environment P pollution especially in water resources at animal production areas

8. Aim of study to provide phytase gene (phyA) suitable for protein expression into phytase enzyme to supplement poultry feed in Palestine

9. Materials and Methods Aspergillus niger strain 103 isolation RNA Extraction from Aspergillus niger cell Collection and cDNA Synthesis from mRNA that Extracted from Aspergillus niger

10. Amplification and Visualization of a phytA Gene from Aspergillus niger cDNA To amplify the cDNA phytA gene, DNAMAN software was used to design primers based on the phytA sequence NCBI accession number AB022700 as follows: Phytase F 5`- ATGGGTGTCTCTGCCGTTCTAC -3` phytase R 5`- CTAAGCGAAACACTCCCCCC -3`

11. Cloning of phytA Gene in pGEM® -T Easy vector

12. Transformation into DH5α Screening and Verification of Positive Clones

13. Sequencing of purified plasmid Subsequent Cloning of phytA Gene into p PROEXH-Tb Expression Vector

14. Induction and Purification of phytase

15. Results and Discussion Aspergillus niger Growth and RNA Extraction

16. Cloning of PhytA Gene Aspergillus niger 1500 bp 1000 bp 900 bp

17. Successful cloning of phytA gene in p GEM-T- Easy cloning vector, Cloning was verified by PCR 1500 bp

18. Sequence information and homologies of the cloned phytA gene

21. Conclusion We have now a clone of phyA gene which is 98% homology to aspergillus niger phytase gene at NCBI

22. Future work We work now on the expression of phytase enzyme in order to supplement it to poultry