Download presentation
Presentation is loading. Please wait.
Published byKristina Gordon Modified over 9 years ago
1
Molecular Epidemiology: Impact on Food Regulation and Future Needs
Bala Swaminathan, Ph.D. Vice-President, IHRC, Inc. Atlanta, GA, USA
2
Epidemiology Epidemiology: the study of the distribution and determinants of health-related states in specified populations, and the application of this study to control health problems. Epidemiologists collect data about an entire population through surveillance systems or descriptive epidemiological studies. use these data to generate hypotheses about the relationships between exposure and disease. test the hypotheses by conducting analytical studies such as cohort or case-control studies. use the findings from these studies to develop, recommend and/or implement some form of community intervention to end the health problem and prevent its recurrence.
3
Molecular Biology Molecular biology involves the study of macromolecules (DNA, RNA, proteins) and the macromolecular mechanisms found in living things, such as the molecular nature of the gene and its mechanisms of gene replication, mutation, and expression. In the context of infectious disease epidemiology, the molecular biologic approach involves molecular characterization of disease –causing organisms and their subdivision by their DNA, RNA and/or proteins. DNA “fingerprinting” Subtyping Molecular subtyping
4
Molecular Epidemiology = Epidemiology of disease in affected population + Molecular Characterization (subtyping) of Etiologic Agent Synergy between two seemingly disparate scientific disciplines
5
Example of Molecular Subtyping
PulseNet Universal Reference Standard Fragment Size 1135 Kb 452.7 Kb 216.9 Kb 76.8 Kb 33.3 Kb A typical E. coli O157:H7 PFGE Gel
6
National network of public health laboratories
State and local public health departments and Federal agencies (CDC, USDA-FSIS, FDA) Routinely perform standardized molecular subtyping of foodborne disease-causing bacteria Share DNA “fingerprints” electronically in real-time via Internet Dynamic database of DNA “fingerprints” at CDC My name is Efrain Ribot and am here to tell you about some of the develpments we experienced in PulseNet in the past few years. I wanted to show you this slide first to establish the fact that pulsenet is collaborative effort between CDC and other organizations and agencies, such as APHL, CSTE, USDA-FSIS, and FDA. This partnership is what has made PulseNet the public health success story it is today.
7
Personnel from labs in all 50 states have received formal training either at CDC or one of the area laboratories. This map helps us get a visual image of the network which is divided in 8 different regions (areas represented with different colors). Each region has an are laboratory—represented by desk top computer icons. Area labs have additional responsibilites—support, troubleshooting, over flow of isolates.. NAME the different labs—locations (MA, VA, MI, MN, TX, UT, WA, and CDC acting as the area lab for the southeastern US. USDA-FSIS is represented by the pork chop--, FDA, CVM
8
Participation in PulseNet International
33 13 13
9
E. Coli O157 Outbreak – Minnesota, 2000
Jan Feb Mar Apr May Jun Jul Aug Sep No. of cases Month 2 4 6 8 10 12 14 16 18 20 22 Oct Nov Dec E. Coli O157 Outbreak – Minnesota, 2000 Courtesy: John Besser, MN State Health Dept
10
Statistical Association with Consumption of Hamburger from Cub Foods; 2000
Nov Dec No. of cases 2 4 6 8 10 12 14 16 18 20 22 With PFGE OR = 17.1; p = 0.005 -SIGNIFICANT- Without PFGE OR = 1.93; p = 0.31 -NOT significant- Courtesy: John Besser, MN State Health Dept
11
Criminal investigation:
Odds of exposure given illness Outbreak investigation: Courtesy: John Besser, Minnesota Dept. of Health
12
What are the Standards of Evidence for Molecular Epidemiology?
Strong epidemiologic association between illness in outbreak-related cases and implicated food Pathogen isolated from implicated food Pathogen isolates subtyped validated methods Pathogen subtyping data corroborate epidemiologic findings (case patient isolates are indistinguishable/nearly indistinguishable from implicated food isolates) If subtyping data do not corroborate epidemiologic findings, appropriate and acceptable explanation of discrepancy
13
E. coli O157 Outbreak 0609mlEXH-2 No. entries in The PulseNet
database before 8/15/2006 N= 22,532 157 (0.7%) 594 (2.6%) Extra band at approx. 145Kb EXHX EXHX For outbreak detection, must use stringent criteria to define subtype of outbreak strain unless epidemiologic findings indicate the need more inclusive criteria
14
Impact of Molecular Epidemiology on Food Regulation
Incidence of reported cases and outbreaks of listeriosis in the United States, * Multistate outbreak PulseNet begins subtyping Listeria Single state outbreak *Data from active surveillance systems, Some data are preliminary
15
Remedies: Better labeling and Consumer Education
Impact of Molecular Epidemiology on Food Regulatory Policy – Recent Example Recent outbreaks involving frozen processed foods that are not fully-cooked but require microwave cooking or conventional cooking before consumption. Largest of these outbreaks spanned a period of more than one year, and caused illness in more than 400 people in 41 states. Vehicle of transmission in this outbreak frozen pot pies containing poultry meat Pathogen was Salmonella serotype Typhimurium or a monophasic variant of the same serotype . Two other salmonellosis outbreaks detected and investigated in Minnesota between 2005 and 2006. Frozen, pre-browned, single-serving, microwavable stuffed-chicken entrees were involved in both outbreaks. Between 1998 and 2005, Minnesota had detected two more outbreaks caused by similar products Common features of all outbreaks Molecular epidemiology enabled public health authorities to recognize and promptly investigate the outbreaks Posting of the outbreak pattern on the national PulseNet database served as the trigger for other states to look for cases in their own states although the packages of the products implicated in these outbreaks had cooking instructions which, if strictly followed, may have inactivated the Salmonella, the presentation and packaging of the product may have led the consumer to assume that they were fully cooked and, therefore, only needed to be heated to an appropriate temperature for consumption. Remedies: Better labeling and Consumer Education
16
Public Health Impact of Molecular Epidemiology
outbreak detected 1993 Meat recall 1993 Western States E. coli O157 Outbreak 726 cases 4 deaths 39 d outbreak detected 2002 18 d CL PHL: 0-7 d PHL: 4-7 d If only 5 cases of E. coli O157:H7 infections were averted by the recall of ground beef in the Colorado outbreak, the PulseNet system would have recovered all costs for start up and operation for 5 years. (Elbasha et al. Emerg. Infect. Dis. 6: , 2000)
17
Largest U.S. Food Recalls (> 750,000 lbs) in which Molecular Epidemiology Has Played a Prominent Role Year Pathogen Food Food recalled (lbs) 2007 E. coli O157:H7 Ground beef 21,700,000 5,700,000 Ground Beef 800,000 2006 Salmonella Tennessee Peanut Butter 345,000,000 2005 Salmonella Enteritidis Almonds 13,000,000 2003 Blade Tenderized Frozen Steak 750,000 2002 Listeria monocytogenes Ready-to-eat poultry products 27,400,000 18,600,000 2000 16,900,000 1,100,000 1998 Hot dogs, deli meats 35,000,000 Salmonella Agona Toasted oats cereal 3,000,000 1997 Frozen ground beef 25,000,000 127,000,000 Total = 513,950,000 lbs other recent notable outbreaks: Salmonella Typhiumrium Stuffed chicken products, pot pies Millions 2007 Salmonella Wandsworth “Veggie bootie” snacks unknown E. coli O157:H7 Sprouts, bagged lettuce, fresh spinach
18
Molecular Epidemiology: Further Improvements Needed
Reduce delays in pathogen subtyping and submission of patterns to national databases Implement more discriminating and epidemiologically relevant subtyping methods to complement or replace existing methods; PFGE will continue to be used for the next few years Reduce/eliminate disparities in state/local capacities for molecular epidemiology of foodborne diseases Develop/implement innovative strategies for timely and routine gathering of epidemiologic data independently and in parallel with molecular subtyping “Team Diarrhea” concept works; Can the “Team Diarrhea” approach be replicated in other states, regionally or nationally?
19
Next Generation Subtyping Methods for Molecular Epidemiology
MLVA typing Already in use for E. coli O157:H7 subtyping in PulseNet SNP (single nucleotide polymorphism) analysis Under development and evaluation Whole genome sequencing On the horizon
20
Multilocus VNTR Analysis (MLVA)
Variable Number Tandem Repeats (VNTRs) in non-coding sequences Conserved repeat motif found in the genome Example: TAACCG Variable numbers of repeat units among isolates of the same species MLVA examines the number of repeats at multiple loci to determine genetic relationships Number of repeats TAACCG 1 2 4 5 Isolate A Isolate B Isolate C Isolate D TAACCGTAACCG TAACCGTAACCGTAACCGTAACCG TAACCGTAACCGTAACCGTAACCGTAACCG
21
Variable Number Tandem Repeats VNTRs
Insertion Deletion
22
Multiple Locus VNTR Analysis can be developed from low-pass sequence data
23
Clustering of outbreak isolates and some selected sporadic isolates by MLVA
GA water park outbreak CT apple cider outbreak CO outbreak NJ outbreak Western States outbreak WI restaurant outbreak NY County Fair MI outbreak
24
Table 1. SNP genotype (SG) and clade for several Escherichia coli O157:H7 outbreak
strains along with hospitalization and hemolytic uremic syndrome (HUS) rates by outbreak. Strain Year SG Clade Outbreak No. cases No. (%) hosp. No. (%) HUS RIMD * 1996 1 Radish sprouts, Sakai, Japan 8,355 398 (5) 0 (0) 93-111 1993 9 2 Hamburger, Northwest U.S. 583 171 (29) 41 (7) EDL-933* 1982 12 3 Hamburger, MI and OR 47 33 (70) TW14359 2006 30 8 Spinach, Western U.S. 204 104 (51) 31 (15) TW1458a Lettuce, Eastern U.S. 71 53 (75) 8 (11) 350 EHEC O157 outbreaks in the USA ( ) 8,598 1,493 (17) 354 (4) Manning, et al. (2008)
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.