1. Molecular and Organismal Development Chapter 21: pp 411-429 Chapter 47: pp 992-1008

2. Topics in Development 1. totipotency: development depends on selective expression of the whole genome present in every cell. 2. blastula to gastrula: comparative analysis yields insights into the general nature of development 3. the three fundamental processes: –cell division (differential rates of division are critical, programmed cell death is significant) –cell differentiation (changes in integration and shape are critical; targeting cells with signals is a critical part of the process) –morphogenesis of tissues and organs (includes defining the individual’s polarities, dividing the organism into segments, and – in animals -- migration of cells in tissue origin)

3. Figure 21.2 Some key stages of development in animals and plants

4. Figure 21.5 Test-tube cloning of carrots

5. Figure 21.8 Working with stem cells

6. Topics in Development 1. totipotency: development depends on selective expression of the whole genome present in every cell. 2. blastula to gastrula: comparative analysis yields insights into the general nature of development 3. the three fundamental processes: –cell division (differential rates of division are critical, programmed cell death is significant) –cell differentiation (changes in integration and shape are critical; targeting cells with signals is a critical part of the process) –morphogenesis of tissues and organs (includes defining the individual’s polarities, dividing the organism into segments, and – in animals -- migration of cells in tissue origin)

7. Figure 47.6 Cleavage in an echinoderm (sea urchin) embryo

8. Figure 47.9 Sea urchin gastrulation (Layer 3)

9. Figure 47.8x Cleavage in a frog embryo

10. Figure 47.8d Cross section of a frog blastula

11. Figure 47.10 Gastrulation in a frog embryo

12. Figure 47.12 Gastrulation in a frog embryo

13. Figure 47.12 Cleavage, gastrulation, and early organogenesis in a chick embryo

14. The cells in the three germ layers have defined fates in the adult:

15. Topics in Development 1. totipotency: development depends on selective expression of the whole genome present in every cell. 2. blastula to gastrula: comparative analysis yields insights into the general nature of development 3. the three fundamental processes: –cell division (differential rates of division are critical, programmed cell death is significant) –cell differentiation (changes in integration and shape are critical; targeting cells with signals is a critical part of the process) –morphogenesis of tissues and organs (includes defining the individual’s polarities, dividing the organism into segments, and – in animals -- migration of cells in tissue origin)

16. Figure 21.4 Cell lineage in C. elegans

17. C. elegans cell targeting

19. Figure 47.14 Organogenesis in a frog embryo

20. Figure 47.16 Change in cellular shape during morphogenesis

21. Apoptosis in development

22. Topics in Development 4.Homeotic genes a. the determination of appendage identity on fruitfly segments b. the evolution of form in segmented animals 4.Morphogenesis in Plants 5.Organ identity genes in flower development

23. Figure 21.11 Key developmental events in the life cycle of Drosophila

24. Figure 21.12 The effect of the bicoid gene, a maternal effect (egg-polarity) gene Drosophila

25. Figure 21.13 Segmentation genes in Drosophila

26. Figure 21.13 Homeotic mutations and abnormal pattern formation in Drosophila

27. The homeodomain - 60 amino acids of the homeotic gene product that remain very similar in all proteins made by homeotic genes. Homeotic genes:the DNA sequence of the gene (blue) contains a 180 bp sequence—the homeobox—(red) that is highly conserved.

28. Figure 17.7 The initiation of transcription at a eukaryotic promoter

29. control of transcription in C.elegans lin-3 | tctctccctattcaatgcacctgtgtattttatgctggttttttcttgtgaccctgaa aactgtacacacaggtgttcttaccaatgtctcaggcatttttggaaaagta atattaagaaaattatacatattttcttgaatacgaaaaatttaaATGTTC GGTAAATCGATTCCTGAACGACTTCTAGTCGCATTT HLH-2 binding site NHR binding site EXON is in uppercase letters.

30. Figure 19.10 Three of the major types of DNA-binding domains in transcription factors

31. The homeobox is relatively constant because it has a precise job.

33. Figure 21.14 Homologous genes that affect pattern formation in a fruit fly and a mouse

34. Topics in Development 4.Homeotic genes a. the determination of appendage identity on fruitfly segments b. the evolution of form in segmented animals 4.Morphogenesis in Plants 5.Organ identity genes in flower development

35. Serial Homology of the Lobster

36. CRUSTACEANS COMPARED - EVOLUTIONARY HOMOLOGY

37. CRUSTACEANS COMPARED: EVOLUTIONARY TRANSFORMATION LOBSTER ROCK CRAB

38. Figure 33.28 Horseshoe crabs, Limulus polyphemus

39. Figure 33.27 A trilobite fossil

40. Figure 33.x1 Insecta: beetle

41. Figure 32.8 Animal phylogeny based on sequencing of SSU-rRNA lophophore

42. Figure 32.13x Burgess Shale fossils

43. Figure 32.13 A sample of some of the animals that evolved during the Cambrian explosion

44. Porifera and Cnidaria are prominent in the Burgess Shale Annelid worms in the Burgess shale

45. Anomalocaris hunts so are arthropods!!

46. Figure 26.8 The Cambrian radiation of animals Causes of the radiation: 1.Atmospheric oxygen reaches sufficient levels. 2.Predator-prey relationships originate. 3.Homeobox genes evolve. (Ediacaran) 525 Burgess Shale PL PE D D R P

47. Evolutionary changes in the timing of homeobox genes yield morphological change. Artemia, the brine shrimp

48. Another representation of the sequence of homeotic gene expression in an arthropod. Notice the continued prominence of Antp, Ubx, and Abd paralogs.

49. Timing of expression of the homeobox genes Antp, Ubx, and AbdA. Fading lines indicate weaker expression later in development.

50. Number of homeobox paralogs increases in arthropods. This illustration also shows change in timing of gene expression.

51. Dm - Fruitfly Tc - Beetle Jc - Butterfly Ak - Onycho- phoran Amino acid sequences compared for the homeotic gene Ubx insects arthropods Decides six legs versus more

52. Topics in Development 4.Homeotic genes a. the determination of appendage identity on fruitfly segments b. the evolution of form in segmented animals 4.Morphogenesis in Plants 5.Organ identity genes in flower development

53. Figure 35.13 Morphology of a winter twig

54. Goethe’s inspiration - the European Fan Palm at the Padua Botanical Garden Johann Wolfgang von Goethe 1749 - 1832 Padua Botanical Garden

55. SERIAL HOMOLOGY - GOETHE’S PALM

56. Figure 35.17 The terminal bud and primary growth of a shoot

57. Figure 21.20a Organ identity genes and pattern formation in flower development: Normal flower development from Campbell, 6 th edition

58. A set of homeotic genes, in different combinations, yield the different floral organs. A CBE

59. Figure 21.20b Organ identity genes and pattern formation in flower development: In situ hybridization from Campbell, 6 th edition

60. The evolutionary determination of sepal and petal. ACB2B2 B1B1 B3B3

61. Topics in Development 4.Homeotic genes a. the determination of appendage identity on fruitfly segments b. the evolution of form in segmented animals 4.Morphogenesis in Plants 5.Organ identity genes in flower development