Download presentation
Presentation is loading. Please wait.
Published byBrittney Douglas Modified over 9 years ago
1
Francis K. Lee, M.Sc, Ph.D. Senior Service Fellow (Research Microbiologist) Newborn Screening Translation Research Initiative, CDC Emeritus Professor of Pediatrics, Emory University School of Medicine Newborn Screening Molecular Workshop June 28-30, 2011 T Cell Receptor Excision Circle (TREC) Assay for Newborn Screening of SCID National Center for Environmental Health · Division of Laboratory Sciences Newborn Screening and Molecular Biology Branch
2
Severe Combined Immunodeficiency (SCID) is characterized by the absence of both humoral and cellular immunity At least 15 different genes known to cause SCID when mutated All have profound defects in T lymphocyte differentiation and function Maternal antibodies wane during first months of life - affected infants develop infections (common / opportunistic pathogens) Recurrent infections, chronic diarrhea, sepsis, FTT Death usually before 1 year of age Overview of SCID – the Condition SCID has been called “Bubble Boy Disease” Treatment and prevention of infections can prolong life but are not curative Best hope for SCID patients is Hematopoietic Stem Cell Transplant before the onset of infections
3
SCID classification X-linked SCID: Mutation in the γ chain common to IL-2, IL-4, IL- 7, IL-9, IL-17 & IL-21 receptors Autosomal Recessive SCID: Adenosine Deaminase deficiency (20q13.11) Jak3 tyrosine kinase deficiency (19p13.1) RAG 1 or 2 defect (11p13) IL-7R deficiency ( chain) (5p13) Purine Nucleoside Phosphorylase deficiency (14q13) MHC II deficiency (16p13, 1q21, 13q) CD3 and CD3 mutations (11q23) CD45 deficiency ZAP-70 deficiency- (2q12 ) Artemis (10p)
4
Mutations in IL2R gamma chain NHIGRI, NIH: Genbank accession number L19546
5
Common Feature: ABSENT/NON-FUNCTIONAL T CELLS TRECs: Reduced in All Forms of SCID IL2R T-B+NK- JAK3T-B+NK- IL7R T-B+NK+ CD45T-B+NK+ RAG1T-B- NK+ RAG2T-B- NK+ ARTEMIST-B- NK+ ADAT-B-NK- Reticular DysgenesisT-B+NK+ SCID, multiple bowel atresiasT-B+/-NK+ SCID, congenital abnormalities T-B+/-NK+ Severe DiGeorge SyndromeT-B+/-NK+ CD3 DeficiencyT+/-B+NK+ CD8 DeficiencyT+B+NK+ Severe Ataxia TelangiectasiaT+/-B+/-NK+ Unknown genetic Defect ~5-25%
6
Prevalence of the disease 1:100,000 or greater SCID: 1:50,000-1:100,000 Can the disorder be detected by routine physical exam? SCID: Baby appears normal at birth. Does the disease cause serious medical complications? SCID: 100% fatal within the first year of life Is there a cheap, sensitive and specific screening test? SCID: Real time PCR to enumerate T cell receptor excision circles Is there a confirmatory test? SCID: Lymphocyte subpopulation analysis Does early detection improve outcome? SCID: Early HSCT decreases mortality from SCID SCID Meets NBS Criteria
7
Optimal Test to Screen for severe T cell lymphopenia (SCID) Must detect low/absent T cells Use existing NBS screening cards Inexpensive, sensitive and specific Low rate of false positive tests Little need for retesting Real Time PCR (RT-PCR): enumeration of T cell receptor excision circles (TREC - surrogate marker for recently produced T cells) using DNA extracted from newborn blood spots collected routinely on all newborns
8
The T cell Receptor Excision Circle (TREC) assay differs from other molecular assays used in NBS: Phenotype assay: TREC is a molecular marker for T cell production in thymus Quantitative assay: require higher level of precision results influence d by DNA extraction efficiency PCR efficiency Overview of TREC Assay for SCID
9
T cell receptor excision circles (TREC) are by-products of the rearrangement of T cell receptor (TCR) genes during thymocyte maturation in the thymus TRECs are episomal DNA and do not replicate during mitosis Peripheral blood TREC levels reflect T lymphocyte production in the thymus TREC Assay: Real Time PCR Variations in TREC Assay procedures can be based on: Primers and Probes DNA extraction procedures Overview of TREC Assay for SCID (cont.)
10
Alpha chain V segments Delta chain V/D/J segments Alpha chain J segments Alpha chain constant region TCR–Delta deletion in rearrangement of T cell receptor gene Vα1Vα1 Vα2Vα2 VαnVαn δRec Vδ1Vδ1 Vδ/Dδ/JδVδ/Dδ/Jδ CδCδ ψЈαψЈα Jα2Jα2 Jα1Jα1Jα3Jα3 JαnJαn CαCα ↓ ↓ δRec-ΨJα Coding joint Signal joint δRec-ΨJα TREC ≈ ≈ ≈ ≈ ↓ Vα–Јα–Cα rearrangement ↓ TCR alpha chain transcription, translation, expression ≈ ≈ ≈ ≈ ≈ ≈ ≈ ≈ Chromosomal 14 TCR α/δ chain loci Episomal DNA (δRec-ΨJα TREC) Chromosomal 14 TCR α chain locus Chromosomal 14 TCR α/δ chain loci
11
GTGTCCTCACCCGTGAAA GTCCACGGATACGTAGTGGCAC 5’3’ ≈ δRecΨЈαΨЈα 5’ -------AAAGGTGCCCACTCCTGTGCACGGTGATGCATAGGCACCTG-------3’ ≈ Orientation of δRec and ΨЈα sequences in genomic DNA Orientation of δRec and ΨЈα sequences in TREC DNA Signal Joint Forward Primer Direction →← Reverse Primer Direction
12
DBS DNA Extraction TREC sequence Amplification Amplicons Quantification DBS DNA Extraction Real time PCR DBS In Situ PCR Amplicons Quantification DBS In Situ Real time PCR ClassicalConventionalPECDC Technical Approaches to TREC Assays
13
TREC Measurement: qPCR
14
In Situ Real Time PCR Assay for TREC Punch one 2.0 mm discs from DBS specimen into PCR tubes Wash with 125 µl of DNA purification solution S1 (shake for 15 minutes at room temp) Wash with 125 µl of DNA elution solution S2 (shake for 5 minutes at room temp)
15
In Situ Real Time PCR Assay for TREC (cont.) Discard S2 wash buffer Add 15 μl of qPCR mastermix (contains complete mix of primers & probe) Run qPCR in Stratagene MX3000p: 45 deg for 5 min, 95 deg for 20 min 45 cycles of [ 95 deg x 15 sec + 60 deg x 1 min ]
16
Quality Assurance Use of TREC Reference Materials National Center for Environmental Health Newborn Screen and Molecular Biology Branch
Similar presentations
© 2025 SlidePlayer.com. Inc.
All rights reserved.