1. Lac Operon Gene Regulation in action

2. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The process for determining when transcription occurs –or what factors determine that

3. Introns and Exons Eukaryotic DNA differs from prokaryotic DNA it that the coding sequences along the gene are interspersed with noncoding sequences The coding sequences are called EXONS The non coding sequences are called INTRONS

5. Lac Operon Found in E. Coli –Bacteria –Prokaryote Determines the balance between enzyme and substrate What really happens when we make protein?- requirements –Amino acids, transcription, translation- don’t forget ATP

6. Lac Operon Waste of energy? –You bet! How do we make sure we can make proteins only when we need them –How do we get lights only when we need them –How do we get electricity in this thing

7. Lac Operon Reminder about bacteria –Bacteria- 1 chromosome –Bacteria- one strand –DNA is circular

8. Lac Operon Many of our old buddies are still around –DNA –RNA –Factors –Helicase - Polymerase

9. Video Time!

10. New Terms Promoter region –Place upstream important for binding in DNA Controller/operator regions –Where Operon binds in Lactose –the sugar

11. Enzymes Permease –Protein allow items into the cell Beta-galactosidase –Breaks down glucose Transacetylase- ?

12. Look at the DNA PromoterRegionOperatorSequenceCodingRegionTerminatorSequence DNA Sequence

13. PromoterRegionOperatorSequenceCodingRegionTerminatorSequence Lac Operon in action ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC

14. PromoterRegionOperatorSequenceCodingRegionTerminatorSequence Lac Operon in action If there is no lactose present, the inhibitor is bound to the operator (Operon) sequence. ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC

15. PromoterRegionOperatorSequenceCodingRegionTerminatorSequence Lac Operon in action If there is no lactose present, the inhibitor is bound to the operator (Operon) sequence. No space for polymerase to reach where it needs to. ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC Inhibitor

16. PromoterRegionOperatorSequenceCodingRegionTerminatorSequence Lac Operon in action If there is no lactose present, the inhibitor is bound to the operator (Operon) sequence. No space for polymerase to reach where it needs to. ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC Inhibitor RNAPOL

17. PromoterRegionOperatorSequenceCodingRegionTerminatorSequence Lac Operon in action No space for polymerase to reach where it needs to. Lactose solution added ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC Inhibitor RNAPOL

18. What’s Lactose again?

19. PromoterRegionOperatorSequenceCodingRegionTerminatorSequence Lac Operon in action Lactose solution added Lactose binds to the inhibitor ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC Inhibitor RNAPOL

20. PromoterRegionOperatorSequenceCodingRegionTerminatorSequence Lac Operon in action Lactose binds to the inhibitor Lactose causes inhibitor no longer bind to the operator sequence ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC RNAPOL Inhibitor

21. PromoterRegionOperatorSequenceCodingRegionTerminatorSequence Lac Operon in action Lactose causes inhibitor no longer bind to the operator sequence RNA Polymerase can now transcribe ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC RNAPOL Inhibitor

22. PromoterRegionOperatorSequenceCodingRegionTerminatorSequence Lac Operon in action Lactose causes inhibitor no longer bind to the operator sequence RNA Polymerase can now transcribe ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC RNAPOL CCCCCGCCCCCGCCCCCUAU RNA

23. Three mRNA “recipes” are made Permease –Protein allow items into the cell Beta-galactosidase –Breaks down glucose Transacetylase They also get translated!

24. PromoterRegionOperatorSequenceCodingRegionTerminatorSequence Lac Operon in action Transcription continues to occur until lactose levels get low in the solution ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC RNAPOL CCCCCGCCCCCGCCCCCUAU RNA

25. PromoterRegionOperatorSequenceCodingRegionTerminatorSequence Lac Operon in action Transcription continues to occur until lactose levels get low in the solution Then the inhibitor binds back into the operator sequence ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC RNAPOL Inhibitor

26. The End

27. DNA