1. Aulani "Biokimia" Presentation 9 NUCLEIC ACID Aulanni’am & indra Wibowo Biochemistry Laboratory Chemistry Departement Brawijaya University

2. Aulani "Biokimia" Presentation 9 NUCLEIC ACID DNA, RNA, and Flow of Genetic Information DNA (deoxyribonucleic acid) RNA (ribonucleic acid )

3. Aulani "Biokimia" Presentation 9 DNA RNA PROTEIN Transcription Translation Reverse Transcription Replication Central Dogma Biology Molecular/ Genetic Information

4. Aulani "Biokimia" Presentation 9 Genetic Information ATGGTTTTCAGTGGAGTCATCCTTTCTGCTCTG GTTATGTTTCTGCTTTCTGACAGTGCGCAGTG CAGAAGAGTCGACTGCAAGACTGACTGTTGCT CATTTGTGGAGGGCTTTCCAGTGAGACTCAAG GAGCTCCGTTCTGCATACAGAGAAATACAGAA CTTTTATGAGTCCAATGATGACATGGAACCATT ACTGGACGAAAACGTGGAACAGAATATCAATA GENETIC CODES

5. Aulani "Biokimia" Presentation 9 phosphate sugar base phosphate sugar base phosphate sugar base Structure of Nucleic Acids: Primary structures both are linear polymers (multiple chemical units) composed of monomers (single chemical units), called nucleotides sugar phosphate base sugar phosphate base Nucleic Acid Structure Functions of Nucleic Acids: contain the information prescribing amino acid sequence in proteins serve in the several cellular structures that choose, and then link into the correct order, the amino acids of a protein chain

6. Aulani "Biokimia" Presentation 9 Nucleotides are the Monomeric Units of Nucleic Acid nucleoside nucleotide

7. Aulani "Biokimia" Presentation 9 RNA and DNA Differ in the Sugar Component First Component

8. Aulani "Biokimia" Presentation 9 Phosphates Second Component

9. Aulani "Biokimia" Presentation 9 Phosphodiester Linkage Formation The chain-elongation reaction catalyzed by DNA polymerases is a nucleophilic attack by the 3’-hydroxyl group of the primer on the innermost phosphorus atom of the deoxynucleoside triphosphate

10. Aulani "Biokimia" Presentation 9 Backbones of DNA and RNA Phosphodiester bond 3’ linkage5’ linkage RNA: 3’  5’ phosphodiester bond 2’  5’ phosphodiester bond (function in RNA Splicing)

11. Aulani "Biokimia" Presentation 9 To maintain the integrity of information stored in nucleic acids negative charge resistance to hydrolysis Function of the Nucleic Acid Backbones

12. Aulani "Biokimia" Presentation 9 Purines and Pyrimidines RNA DNA Third Component

13. Aulani "Biokimia" Presentation 9 Specific hydrogen bonding between G and C and between A and T (or A and U) generates complementary base-pairing Four Bases as Base Pairs of DNA

14. Aulani "Biokimia" Presentation 9 β-Glycosidic Linkage in a Nucleoside 1’ 2’ 3’ 4’ 5’

15. Aulani "Biokimia" Presentation 9 Naming Nucleosides and Nucleotides (Nomenclature)

16. Aulani "Biokimia" Presentation 9 Adenosine 5’-triphosphate (5’-ATP)/ 5’-deoxyadenylate Deoxyguanosine 3’-monophosphate (3’-dGMP) Naming Nucleosides and Nucleotides (Nomenclature)

17. Aulani "Biokimia" Presentation 9 Structure of a DNA Chain A DNA chain has polarity. One end has a free 5’-OH group attach to a phosphate Other end has a 3’-OH group The base sequence is written in the 5’ to 3’ direction

18. Aulani "Biokimia" Presentation 9 A Pair of Nucleic Acid Chains with Complementary Sequences Can Form a Double-Helical Structure X-Ray Diffraction Photograph of a Hydrated DNA Fiber (Maurice Wilkins and Rosalind Franklin) Watson-Crick Model of Double-Helical DNA

19. Aulani "Biokimia" Presentation 9

20. 34 Å Helix Antiparallel, hydrogen bond Sugar-phosphate backbones outside, bases inside the helix, minor and major grooves Bases and axis nearly perpedicular Helix diameter 2 nm (20 Å) Adjacent bases are separated by 3.4 Å The helical structure repeats every 34 Å (10 bases/turn) Watson-Crick Model of Double Stranded-DNA

21. Aulani "Biokimia" Presentation 9 The Double Helix is Stabilized by Hydrogen Bonds and Hydrophobic Interactions The stacking of bases one on top of another contributes to the stability of the double helix in two ways: 1.van der Waals interactions 2.hydrophobic effect Rigid five-carbon sugar (pentose)

22. Aulani "Biokimia" Presentation 9 Two Possible Helical Forms of DNA are Mirror Images of Each Other The geometry of the sugar-phosphate backbone of DNA causes natural DNA to be right-handed

23. Aulani "Biokimia" Presentation 9 Models of Various DNA Structures that are Known to Exist The B form of DNA, the usual form in cells, is characterized by a helical turn every 10 base pairs (3.4 nm) The more compact A form of DNA has 11 base pairs per turn and exhibits a large tilt of the base pairs with respect to the helix axis Z DNA is a left-handed helix and has a zig-zag (hence "Z") appearance

24. Aulani "Biokimia" Presentation 9 Some DNA Molecules are Circular and Supercoiled

25. Aulani "Biokimia" Presentation 9 The Denaturation and Renaturation of Double-Stranded DNA Molecules

26. Aulani "Biokimia" Presentation 9 DNA Synthesis is catalyzed by DNA Polymerases Occur at all places of DNA chain, 5’  3’ direction Semiconservative The Double Helix Facilitates the Accurate Transmission of Hereditary Information

27. Aulani "Biokimia" Presentation 9 Several Kinds of RNA Play Key Roles in Gene Expression mRNA (messenger RNA): is the template for protein synthesis or translation tRNA (transfer RNA): carries amino acids in an activated form to the ribosome for peptide- bond formation rRNA (ribosomal RNA): the major component of ribosomes RNA Molecules Exhibit Varied Conformations and Functions

28. Aulani "Biokimia" Presentation 9 Structural Comparisons between DNA and RNA DNA RNA

29. Aulani "Biokimia" Presentation 9 DNA RNA PROTEIN Transcription Translation Reverse Transcription Replication Central Dogma Biology Molecular/ Genetic Information

30. Aulani "Biokimia" Presentation 9 Transcription Mechanism of the Chain-Elongation Reaction Catalyzed by RNA Polymerase 5’  3’ direction Transcription mRNA Template strand of DNA (antisense) Coding strand of DNA (sense) -strand +strand

31. Aulani "Biokimia" Presentation 9 Promoter Sites for Transcription Start signals are required for the initiation of RNA synthesis in (A) prokaryotes and (B) eukaryotes

32. Aulani "Biokimia" Presentation 9 Transcription, Translation and Reverse Transcription

33. Aulani "Biokimia" Presentation 9 1.Three nucleotides encode an amino acid 2.The code is nonoverlapping 3.The code has no punctuation 4.The genetic code is degenerate The Genetic Code

34. Aulani "Biokimia" Presentation 9 The Genetic Code Codon: A three-nucleotide sequence of DNA or mRNA that specifies a particular amino acid or termination signal; the basic unit of the genetic code Anticodon: A specialized base triplet at one end of a tRNA molecule that recognizes a particular complementary codon on an mRNA molecule

35. Aulani "Biokimia" Presentation 9 tRNA and rNA The structure of the rRNA in the small subunit Phenylalanine tRNA of yeast

36. Aulani "Biokimia" Presentation 9 RNA Processing Generates Mature RNA Splicing exon intron

37. Aulani "Biokimia" Presentation 9 Translation Synthesis of a protein by ribosomes attached to an mRNA molecule. Translation of the mRNA nucleotide sequence into an amino acid sequence depends on complementary base-pairing between codons in the mRNA and corresponding tRNA anticodons. codon anticodon

38. Aulani "Biokimia" Presentation 9 Recombinant DNA Technology Fragmentation, Separation, and Sequencing of DNA Molecules DNA Cloning DNA Engineering

39. Aulani "Biokimia" Presentation 9 GAATTC G AATTC G Sticky Ends (Cohesive Ends) EcoRI CIVIC, Madam G AATTCG Recombinant DNA Technology (Palindrome, Restriction Enzyme, Sticky Ends) G AA TTC G AA TTC Blunt End

40. Aulani "Biokimia" Presentation 9 A B 10 kb 8 kb 2 kb A 7 kb 3 kb B 5 kb 3 kb 2 kb A+BA+B U A B A+B M Restriction enzymes Recombinant DNA Technology (Restriction Mapping) - +

41. Aulani "Biokimia" Presentation 9 GAATTC CTTAAG GAATTC CTTAAG G CTTAA AATTC G G G CTTAA G AATTC G G CTTAA AATTC G G CTTAA AATTC G EcoRI DNA Ligase EcoRI sticky end Recombinant DNA Technology (Restriction and Ligation)

42. Aulani "Biokimia" Presentation 9 Recombinant DNA Technology (Random Fragment Length Polymorfism)

43. Aulani "Biokimia" Presentation 9 Recombinant DNA Technology (Random Fragment Length Polymorfism) recombination

44. Aulani "Biokimia" Presentation 9 Recombinant DNA Technology (Sequencing) Sanger Method: ddNTP Dideoxyadenosine 5’-triphosphate (ddNTP) HH

45. Aulani "Biokimia" Presentation 9 Plasmid gets out and into the host cell Resistant Strain New Resistance Strain Non-resistant Strain Plasmid Enzyme Hydrolyzing Antibiotics Drug Resistant Gene mRNA Recombinant DNA Technology (DNA Cloning: Drug Resistance Gene Transferred by Plasmid )

46. Aulani "Biokimia" Presentation 9 1 plasmid 1 cell Recombinant Plasmid Transformation Target Gene Recombination Restriction Enzyme Restriction Enzyme Chromosomal DNA Target Genes DNA Recombination Transformation Host Cells Recombinant DNA Technology (DNA Cloning: Target Genes Carried by Plasmid )

47. Aulani "Biokimia" Presentation 9 1 1 cell line, 1 colony X100 X1,000 Plasmid Duplication Bacteria Duplication Plating Pick the colony containing target gene =100,000 Recombinant DNA Technology (DNA Cloning: Amplification and Screening of Target Gene )

48. Aulani "Biokimia" Presentation 9 mRNA DNA 5’ 3’ cap poly A tail exon intron mature mRNA Processing Transcription Splicing promotor 3’ 5’ Take place in nucleus start codon stop codon To cytoplasm Intron deleted Recombinant DNA Technology (Libraries: Intron and Exon Organization)

49. Aulani "Biokimia" Presentation 9 mature mRNA poly A tail 5’3’ TTTT Reverse transcription CCC 3’5’ 3’ 5’3’ GGG DNA polymerase RNA hydrolysis 5’ 3’5’ Recombinant DNA Technology (Libraries: cDNA Synthesis)

50. Aulani "Biokimia" Presentation 9 mRNA cDNA Reverse transcription Chromosomal DNA Restriction digestion Genes in expressionTotal Gene Complete gene Gene fragments Smaller Library Larger Library Vector: Plasmid or phage Vector: Plasmid Recombinant DNA Technology (Libraries: cDNA and Genomic)

51. Aulani "Biokimia" Presentation 9 Recombinant DNA Technology (DNA Engineering: Polymerase Chain Reaction )

52. Aulani "Biokimia" Presentation 9 Recombinant DNA Technology (PCR for Forensic Science or PRC Fingerprint)

53. Aulani "Biokimia" Presentation 9 Recombinant DNA Technology (Antisense RNA Strategy)

54. Aulani "Biokimia" Presentation 9 Recombinant DNA Technology (Gene Knockout)

55. Aulani "Biokimia" Presentation 9