1. The 454 and Ion PGM at the Genomics Core Facility Dr. Deborah Grove, Director for Genetic Analysis Genomics Core Facility Huck Institutes of the Life Sciences Penn State University

2. Services DNA Sequencing Illumina, 454 and Ion PGM Next Gen Sequencing Microarray Genotyping – VNTRs, SNPs, Open Array qPCR by Real-Time DNA Synthesis DNA Extraction and Storage of DNA from Buccal Swabs

3. Sequencing at PSU Over the Years MethodManual Gel Bases per Day 1200

4. Cycle Sequencing Reaction

5. Sequencing at PSU Over the Years MethodManual Gel 377 Gel Bases per Day 120020,000

6. Sequencing at PSU Over the Years MethodManual Gel 377 Gel3100 –16 Capillary Bases per Day 1200?20,000100,000

7. Sequencing at PSU Over the Years MethodManual Gel 377 Gel3100 –16 Capillary 3730--96 Capillary Bases per Day 1200?20,000100,0000.5 to 1 million

8. Sequencing at PSU Over the Years MethodManual Gel 377 Gel3100 –16 Capillary 3730--96 Capillary SOLiD Next-Gen Bases per Day 1200?20,000100,0000.5 to 1 million 1 to 2 Billion

9. Next-Generation Sequencers: Massively Parallel Platforms Roche 454FLX+ v2.8 – 500 million bases per run, 800 to 1000 bases Ion PGM 318 chip – 2 to 4 billion bases per run, 400 base length (Ion Proton)

10. Roche 454 – Next Generation Sequencer Pyrosequencing FLX+ v2.8 has 800 to 1000 bp read 160 million bases per full slide 454 FLX +

11. 454 Titanium Sequencing Applications Transcriptome RNA Whole Genome -- Paired-End (3kb, 8kb, 20kb) 15 to 30 ugs dsDNA Whole Genome – Shotgun 500 ngs dsDNA Amplicon/Metagenomics 5 ngs

12. DNA Fragmentation by nebulization Fragment End Repair AMPure Bead Clean up Adaptor-Ligation Small Fragment Removal Library Quality Assessment and Quantification

15. Primer Sets for Metagenomics 16s Bacteria ITS for Fungus 18s set for Fungus and other Eukaryotes, targeting Protists Archaea targeting both Crenarchaeota and Euryarchaeota

16. Amplicon Preparation 27F_M6CGTATCGCCTCCCTCGCGCCATCAGATATCGCGAGAGAGTTTGATCMTGGCTCAG 907R_M6TATGCGCCTTGCCAGCCCGCTCAGCCCCGTCAATTCMTTTGAGTTT

17. 16S Variable Regions 27F_M6CGTATCGCCTCCCTCGCGCCATCAGATATCGCGAGAGAGTTTGATCMTGGCTCAG 907R_M6TATGCGCCTTGCCAGCCCGCTCAGCCCCGTCAATTCMTTTGAGTTT

18. Amplicons 27F 518R 907R

20. One Bead One DNA library NTPs, Taq etc.

29. Ion PGM aka Ion Torrent

30. 314 CHIP316 CHIP

31. Approximate Cost from Genome Library thru Sequencing 314 Chip160 million bases, 400,000 reads 318 Chip3 billion bases, 6 to 8 million reads $1500 to $2000

32. Coverage Full Plate = 1 million reads, 300 million bases ½ plate = 500,000 reads, 150 million bases 1 Quad = 200,000 reads, 60 million bases

33. Coverage

34. Full Plate = 1 million reads, 300 million bases ½ plate = 500,000 reads, 150 million bases 1 Quad = 200,000 reads, 60 million bases http://www.youtube.com/embed/yVf2295JqUg

35. Coverage Full Plate = 1 million reads, 300 million bases ½ plate = 500,000 reads, 150 million bases 1 Quad = 200,000 reads, 60 million bases

36. Full Plate = 1 million reads, 300 million bases ½ plate = 500,000 reads, 150 million bases 1 Quad = 200,000 reads, 60 million bases

37. Full Plate = 1 million reads, 300 million bases ½ plate = 500,000 reads, 150 million bases 1 Quad = 200,000 reads, 60 million bases

38. Applications Bacterial and Viral Genomes Amplicons Ampliseq Panels for SNP variants

39. Ampliseq Cancer Panel Only 10 ngs or less FFPE tissues Single Cells Libraries take 3.5 hours 2800 hot spots

40. Ampliseq Custom Panels Use Ion AmpliSeq Designer

42. P1 Chip 80 million reads, 10 to 15 billion bp PII Chip 300 million reads, 500 to 800 billion bp 314 Chip 160 million bases, 400,000 reads 318 Chip 3 billion bases, 6 to 8 million reads

43. Pac Bio No amplification required Single molecule Several thousand base reads (4 to 20 kb) Least GC-biased sequencing Run time 30 minutes

44. Genomes: Finish Genomes and improve assembly with extra long reads (4000bp average and up to 20,000) Genomic Complexity: Allow haplotype expansion, full length transcripts and splice variants, repeat expansions, minor variants Epigenome: Detects base modifications using kinetics Applications

45. Thanks to: The Huck Institutes of the Life Sciences Lloyd and Dorothy Huck And the others in the lab…