Presentation is loading. Please wait.

Presentation is loading. Please wait.

The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.

Similar presentations


Presentation on theme: "The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome."— Presentation transcript:

1 The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome

2 Short arm Centromere Long arm

3 Maize 1C = 2634 Mb Tomato 1C = 916 Mb Arabidopsis 1C = 157 Mb

4

5 77% of the DNA is in heterochromatin 23% of DNA is in euchromatin

6 77% of the DNA is in heterochromatin 23% of the DNA is in euchromatin Thus, 0.23 x 916 Mb = 211 Mb

7 77% of the DNA is in heterochromatin 23% of the DNA is in euchromatin Thus, 0.23 x 916 Mb = 211 Mb Arabidopsis 1C = 157 Mb

8 HindIII library 15 tomato genome equivalents 129,000 clones Averaging 117 kb

9 EXPEN 2000 MolecularLinkage Map of Tomato Chromosome 10 (SGN)

10 Anchor (seed) BAC LE_HBa0234C10 Probe TG285

11 Anchor (seed) BAC LE_HBa0234C10 Probe TG285 aatgcctaggcatgaatcttggccatc

12 Anchor (seed) BAC LE_HBa0234C10 Probe TG285 aatgcctaggcatgaatcttggccatc gctacgcttagaa

13 Seed BAC LE_HBa0234C10 Probe TG285

14 Seed BAC LE_HBa0234C10 Probe TG285

15 Seed BAC LE_HBa0234C10 Probe TG285

16 Seed BAC Contig LE_HBa0234C10 Probe TG285

17

18 Fluorescence in situ Hybridization (FISH) China France The Netherlands Korea Japan USA

19 Fluorescence in situ Hybridization (FISH) China France The Netherlands Korea Japan USA

20

21

22

23 Nick translation biotin- digoxygenin- dinitrophenol-labeled nucleotides FISH Probes BAC DNA

24 Hybridization mixture 50-100-fold excess of unlabeled tomato Cot 100 DNA Chromosomal in situ Suppression (CISS) Hybridization

25

26

27 Functions of FISH in Sequencing the Tomato Genome 1. To determine the locations of anchor BACs 2. To define eu-heterochromatin borders 3. To determine distances in Mb 4. To locate problem BACs

28 BAC 116C14, Slide 126, Chromosome 9, Short (p) Arm % %

29 Pachytene Chromosome 9

30 Pachytene chromosome 9

31 Functions of FISH in Sequencing the Tomato Genome 1. To determine the locations of anchor BACs 2. To define eu-heterochromatin borders 3. To determine distances in Mb 4. To locate problem BACs

32

33

34 Functions of FISH in Sequencing the Tomato Genome 1. To determine the locations of anchor BACs 2. To define eu-heterochromatin borders 3. To determine distances in Mb 4. To locate problem BACs

35

36 Functions of FISH in Sequencing the Tomato Genome 1. To determine the locations of anchor BACs 2. To define eu-heterochromatin borders 3. To determine distances in Mb 4. To locate problem BACs

37 177 BACs FISHED RESULTS SO FAR

38 177 BACs FISHED 126 BACS (74%) successfully localized. RESULTS SO FAR

39 177 BACs FISHED 51 failed to localize because they either gave no FISH signal or there was more than one signal in spite of CISS hybridization. 126 BACS (74%) successfully localized. RESULTS SO FAR

40 Of 126 BACs localized 22 (17.5%) FISHed to wrong chromosomes

41 Of 126 BACs localized 22 (17.5%) FISHed to wrong chromosomes Of these, 11 have been checked by sequencing: 7 were overgo false positives 1 was due to a picking error 1 was due to a typographical error 2 were due to mapping errors

42 Of 126 BACs localized 22 (17.5%) FISHed to wrong chromosomes Of these 11 have been checked by sequencing: 7 were overgo false positives 1 were due to a picking error 1 were due to a typographical error 2 were due to mapping errors Suggesting ≤ 3% mapping errors on the EXPEN 2000 linkage map

43 FUTURE ACTIVITIES an increasing emphasis on defining the size of gaps in sequencing 1) within BACs, 2) between contigs, 3) between contigs and euchromatin- heterochromatin borders

44 Senior Personnel Undergraduates Lorrie Anderson Madeline Fujishiro Song-Bin Chang Lauren Larsen Suzanne Royer Dylan Westfall Lindsay Shearer Jessica Wu Steve Stack The Role of BAC Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome


Download ppt "The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome."

Similar presentations


Ads by Google